v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-188 precursor secondary structure diagram

Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-188 precursor URS0000221C26_9597

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGCUCCCUCUCUCACAUCCCUUGCAUGGUGGAGGGUGAGCUUUCUGAAAACCCCUCCCACAUGCAGGGUUUGCAGGAUGGCGAGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

  1. Gorilla gorilla gorilla microRNA 188 (ENSGGOG00000031343.2)
  2. Homo sapiens (human) microRNA hsa-mir-188 precursor
  3. Pongo abelii miRNA
  4. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-188 precursor
 2D structure Publications