Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Klebsiella variicola subsp. variicola tRNA-Lys secondary structure diagram

Klebsiella variicola subsp. variicola tRNA-Lys URS000021B2C1_2590157

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGUCGUUAGCUCAGUCGGUAGAGCAGUUGACUUUUAAUCAAUUGGUCGCAGGUUCGAAUCCUGCACGACCCACCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 383 other species

  1. Acinetobacter baumannii tRNA-Lys(ttt)
  2. Aeromonadaceae bacterium tRNA-Lys
  3. Aeromonas diversa CDC 2478-85 tRNA-Lys
  4. Aeromonas diversa tRNA-Lys
  5. Aeromonas schubertii tRNA-Lys
  6. Aeromonas simiae tRNA-Lys
  7. Arsenophonus endosymbiont of Trialeurodes vaporariorum tRNA-Lys
  8. Arsenophonus sp. ENCA tRNA-Lys
  9. Arsenophonus sp. tRNA-Lys
  10. Escherichia coli A-site tRNA from Escherichia coli (PDB 7D6Z, chain 4)
  11. Bruguierivorax albus tRNA-Lys
  12. Brenneria alni tRNA-Lys
  13. Brenneria rubrifaciens tRNA-Lys
  14. Candidatus Fukatsuia symbiotica tRNA-Lys
  15. Candidatus Pantoea multigeneris tRNA-Lys
  16. Candidatus Pantoea persica tRNA-Lys
  17. Candidatus Symbiopectobacterium endolongispinus tRNA-Lys
  18. Candidatus Symbiopectobacterium sp. Dall1.0 tRNA-Lys
  19. Candidatus Symbiopectobacterium sp. 'North America' tRNA-Lys
  20. Candidatus Symbiopectobacterium sp. NZEC127 tRNA-Lys
  21. Candidatus Symbiopectobacterium sp. NZEC135 tRNA-Lys
  22. Candidatus Symbiopectobacterium sp. NZEC151 tRNA-Lys
  23. Candidatus Symbiopectobacterium sp. PLON1 tRNA-Lys
  24. Symbiopectobacterium purcellii tRNA-Lys
  25. Chania multitudinisentens RB-25 tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 4)
  26. Chromatiaceae bacterium (activated sludge metagenome) tRNA-Lys
  27. compost metagenome tRNA-Lys
  28. Dickeya ananatis tRNA-Lys
  29. Dickeya chrysanthemi Ech1591 tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 3)
  30. Dickeya chrysanthemi tRNA-Lys
  31. Dickeya dadantii 3937 tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 3)
  32. Dickeya dadantii subsp. dieffenbachiae tRNA-Lys
  33. Dickeya dadantii tRNA-Lys
  34. Dickeya dianthicola RNS04.9 tRNA-Lys
  35. Dickeya dianthicola tRNA-Lys
  36. Dickeya fangzhongdai tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 3)
  37. Dickeya lacustris tRNA-Lys
  38. Dickeya oryzae tRNA-Lys
  39. Dickeya parazeae Ech586 tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 3)
  40. Dickeya parazeae tRNA-Lys
  41. Dickeya solani D s0432-1 tRNA-Lys
  42. Dickeya solani IPO 2222 tRNA-Lys
  43. Dickeya solani RNS 08.23.3.1.A tRNA-Lys
  44. Dickeya solani tRNA-Lys
  45. Dickeya ananatis Dickeya sp. A5391 tRNA-Lys
  46. Dickeya ananatis Dickeya sp. A5611 tRNA-Lys
  47. Dickeya ananatis Dickeya sp. A6136 tRNA-Lys
  48. Dickeya ananatis Dickeya sp. A6137 tRNA-Lys
  49. Dickeya ananatis Dickeya sp. CFBP 1272 tRNA-Lys
  50. Dickeya ananatis Dickeya sp. CFBP 1278 tRNA-Lys
  51. Dickeya sp. CFBP 2040 tRNA-Lys
  52. Dickeya poaceiphila tRNA-Lys
  53. Dickeya sp. tRNA-Lys
  54. Dickeya sp. ws52 tRNA-Lys
  55. Dickeya undicola tRNA-Lys
  56. Dickeya zeae EC1 tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 3)
  57. Dickeya zeae MS1 tRNA-Lys
  58. Dickeya zeae tRNA-Lys
  59. Enterobacterales bacterium 8AC tRNA-Lys
  60. Enterobacter hormaechei tRNA-Lys
  61. Enterobacteriaceae bacterium ESL0689 tRNA-Lys
  62. Enterobacteriaceae bacterium LUAb1 tRNA-Lys
  63. Enterobacteriaceae bacterium tRNA-Lys
  64. Erwinia sp. OAMSP11 tRNA-Lys
  65. Erwinia sp. OLCASP19 tRNA-Lys
  66. Erwinia sp. OLFS4 tRNA-Lys
  67. Erwinia sp. OLMDSP33 tRNA-Lys
  68. Erwinia sp. OLMTSP26 tRNA-Lys
  69. Erwinia sp. OLSSP12 tRNA-Lys
  70. Erwinia sp. OLTSP20 tRNA-Lys
  71. Escherichia fergusonii ATCC 35469 tRNA-Lys (TTT) (tRNA-Lys-TTT-2-1)
  72. Escherichia fergusonii B253 tRNA-Lys
  73. Escherichia fergusonii tRNA-Lys
  74. Gammaproteobacteria bacterium (activated sludge metagenome) tRNA-Lys
  75. Izhakiella australiensis tRNA-Lys
  76. Pantoea piersonii tRNA-Lys
  77. Kangiellaceae bacterium tRNA-Lys
  78. Klebsiella pneumoniae complex sp. WS1875 tRNA-Lys
  79. Klebsiella pneumoniae complex sp. WS619 tRNA-Lys
  80. Klebsiella pneumoniae tRNA-Lys
  81. Klebsiella sp. C194 tRNA-Lys
  82. Klebsiella sp. C197 tRNA-Lys
  83. Kluyvera sp. tRNA-Lys
  84. Limnobaculum allomyrinae tRNA-Lys
  85. Limnobaculum eriocheiris tRNA-Lys
  86. Limnobaculum parvum tRNA-Lys
  87. Limnobaculum sp. M2-1 tRNA-Lys
  88. Limnobaculum xujianqingii tRNA-Lys
  89. Musicola paradisiaca Ech703 tRNA-Lys (TTT) (tRNA-Lys-TTT-1-1, tRNA-Lys-TTT-1-2)
  90. Musicola paradisiaca tRNA-Lys
  91. Pantoea phytobeneficialis tRNA-Lys
  92. Pantoea sp. ACRSB tRNA-Lys
  93. Candidatus Pantoea deserta tRNA-Lys
  94. Pantoea sp. (terrestrial metagenome) tRNA-Lys
  95. Pantoea sp. X-Soil-OKNW-556 tRNA-Lys
  96. Pantoea sp. X-Soil-OKNW-713 tRNA-Lys
  97. Pantoea sp. X-Soil-TKNS-1279 tRNA-Lys
  98. Pantoea sp. YU22 tRNA-Lys
  99. Pectobacterium aquaticum tRNA-Lys
  100. Pectobacterium araliae tRNA-Lys
  101. Pectobacterium aroidearum tRNA-Lys
  102. Pectobacterium atrosepticum ICMP 1526 tRNA-Lys
  103. Pectobacterium atrosepticum SCRI1043 tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 3)
  104. Pectobacterium atrosepticum tRNA-Lys (TTT) (tRNA-Lys-TTT-2-1, tRNA-Lys-TTT-2-2)
  105. Pectobacterium betavasculorum tRNA-Lys
  106. Pectobacterium actinidiae tRNA-Lys
  107. Pectobacterium brasiliense tRNA-Lys
  108. Pectobacterium brasiliense ICMP 19477 tRNA-Lys
  109. Pectobacterium carotovorum subsp. carotovorum ICMP 5702 tRNA-Lys
  110. Pectobacterium carotovorum subsp. carotovorum PC1 tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 3)
  111. Pectobacterium carotovorum subsp. carotovorum PCC21 tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 3)
  112. Pectobacterium carotovorum subsp. carotovorum tRNA-Lys
  113. Pectobacterium carotovorum subsp. carotovorum UGC32 tRNA-Lys
  114. Pectobacterium carotovorum tRNA-Lys
  115. Pectobacterium colocasium tRNA-Lys
  116. Pectobacterium jejuense tRNA-Lys
  117. Pectobacterium odoriferum tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 3)
  118. Pectobacterium parmentieri tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 3)
  119. Pectobacterium parmentieri WPP163 tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 3)
  120. Pectobacterium parvum tRNA-Lys
  121. Pectobacterium peruviense tRNA-Lys
  122. Pectobacterium polaris tRNA-Lys
  123. Pectobacterium polonicum tRNA-Lys
  124. Pectobacterium punjabense tRNA-Lys
  125. Pectobacterium quasiaquaticum tRNA-Lys
  126. Pectobacterium sinaloense tRNA-Lys
  127. Pectobacterium sp. 1950-15 tRNA-Lys
  128. Pectobacterium sp. 21LCBS03 tRNA-Lys
  129. Pectobacterium quasiaquaticum tRNA-Lys
  130. Pectobacterium sp. A5351 tRNA-Lys
  131. Pectobacterium sp. A5354 tRNA-Lys
  132. Pectobacterium sp. CFBP8739 tRNA-Lys
  133. Pectobacterium sp. CHL-2024 tRNA-Lys
  134. Pectobacterium sp. F1-1 tRNA-Lys
  135. Pectobacterium sp. IFB5596 tRNA-Lys
  136. Pectobacterium sp. PL152 tRNA-Lys
  137. Pectobacterium sp. PL64 tRNA-Lys
  138. Pectobacterium sp. S5 tRNA-Lys
  139. Pectobacterium sp. S6 tRNA-Lys
  140. Pectobacterium versatile tRNA-Lys
  141. Pectobacterium wasabiae CFBP 3304 tRNA-Lys
  142. Pectobacterium wasabiae tRNA-Lys
  143. Pectobacterium zantedeschiae tRNA-Lys
  144. Photorhabdus aballayi tRNA-Lys
  145. Photorhabdus aegyptia tRNA-Lys
  146. Photorhabdus akhurstii subsp. bharatensis tRNA-Lys
  147. Photorhabdus akhurstii tRNA-Lys
  148. Photorhabdus antumapuensis tRNA-Lys
  149. Photorhabdus australis tRNA-Lys
  150. Photorhabdus asymbiotica tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 4)
  151. Photorhabdus asymbiotica UENP tRNA-Lys
  152. Photorhabdus bodei tRNA-Lys
  153. Photorhabdus caribbeanensis tRNA-Lys
  154. Photorhabdus cinerea tRNA-Lys
  155. Photorhabdus hainanensis tRNA-Lys
  156. Photorhabdus heterorhabditis subsp. aluminescens tRNA-Lys
  157. Photorhabdus heterorhabditis tRNA-Lys
  158. Photorhabdus kayaii tRNA-Lys
  159. Photorhabdus khanii NC19 tRNA-Lys
  160. Photorhabdus khanii tRNA-Lys
  161. Photorhabdus kleinii tRNA-Lys
  162. Photorhabdus laumondii subsp. clarkei tRNA-Lys
  163. Photorhabdus laumondii subsp. laumondii tRNA-Lys
  164. Photorhabdus laumondii subsp. laumondii TTO1 transfert RNA-Lys
  165. Photorhabdus laumondii tRNA-Lys
  166. Photorhabdus aegyptia tRNA-Lys
  167. Photorhabdus luminescens subsp. luminescens tRNA-Lys
  168. Photorhabdus luminescens subsp. venezuelensis tRNA-Lys
  169. Photorhabdus luminescens tRNA-Lys
  170. Photorhabdus noenieputensis tRNA-Lys
  171. Photorhabdus sp. HUG-39 tRNA-Lys
  172. Photorhabdus khanii subsp. guanajuatensis tRNA-Lys
  173. Photorhabdus luminescens subsp. mexicana tRNA-Lys
  174. Photorhabdus sp. RW14-46 tRNA-Lys
  175. Photorhabdus sp. S10-54 tRNA-Lys
  176. Photorhabdus sp. S12-55 tRNA-Lys
  177. Photorhabdus sp. S14-60 tRNA-Lys
  178. Photorhabdus sp. S15-56 tRNA-Lys
  179. Photorhabdus sp. S5P8-50 tRNA-Lys
  180. Photorhabdus sp. S7-51 tRNA-Lys
  181. Photorhabdus sp. S8-52 tRNA-Lys
  182. Photorhabdus sp. S9-53 tRNA-Lys
  183. Photorhabdus stackebrandtii tRNA-Lys
  184. Photorhabdus tasmaniensis tRNA-Lys
  185. Photorhabdus temperata J3 tRNA-Lys
  186. Photorhabdus temperata subsp. temperata M1021 tRNA-Lys
  187. Photorhabdus temperata subsp. temperata Meg1 tRNA-Lys
  188. Photorhabdus temperata subsp. temperata tRNA-Lys
  189. Photorhabdus temperata tRNA-Lys
  190. Photorhabdus thracensis tRNA-Lys
  191. Pleionea litopenaei tRNA-Lys
  192. Plesiomonas shigelloides 302-73 tRNA-Lys
  193. Plesiomonas shigelloides (metagenome) tRNA-Lys
  194. Plesiomonas shigelloides subsp. oncorhynchi tRNA-Lys
  195. Plesiomonas sp. PI-19 tRNA-Lys
  196. Plesiomonas sp. tRNA-Lys
  197. Pragia fontium DSM 5563 = ATCC 49100 tRNA_Lys_TTT
  198. Pragia fontium tRNA-Lys
  199. Limnobaculum zhutongyuii tRNA-Lys
  200. Limnobaculum zhutongyuii Pragia sp. CF-917 tRNA-Lys
  201. Providencia alcalifaciens tRNA-Lys
  202. Providencia hangzhouensis tRNA-Lys
  203. Providencia huashanensis tRNA-Lys
  204. Providencia huaxiensis tRNA-Lys
  205. Providencia manganoxydans tRNA-Lys
  206. Providencia pseudovermicola tRNA-Lys
  207. Providencia rettgeri Dmel1 tRNA-Lys
  208. Providencia rettgeri DSM 1131 tRNA-Lys
  209. Providencia rettgeri tRNA-Lys
  210. Providencia sp. 1701011 tRNA-Lys
  211. Providencia sp. 1701091 tRNA-Lys
  212. Providencia sp. 1709051003 tRNA-Lys
  213. Providencia sp. 2023EL-00965 tRNA-Lys
  214. Providencia sp. 2024EL-00732 tRNA-Lys
  215. Providencia sp. 21OH12SH02B-Prov tRNA-Lys
  216. Providencia sp. 2.29 tRNA-Lys
  217. Providencia sp. 504mA tRNA-Lys
  218. Providencia sp. AGC89 tRNA-Lys
  219. Providencia sp. B1 tRNA-Lys
  220. Providencia sp. B2 tRNA-Lys
  221. Providencia sp. B3 tRNA-Lys
  222. Providencia huashanensis tRNA-Lys
  223. Providencia huashanensis tRNA-Lys
  224. Providencia pseudovermicola Providencia sp. DFU6 tRNA-Lys
  225. Providencia sp. KP2202517 tRNA-Lys
  226. Providencia sp. LR1 tRNA-Lys
  227. Providencia sp. Me1 tRNA-Lys
  228. Providencia sp. Me31A tRNA-Lys
  229. Providencia sp. MGF014 tRNA-Lys
  230. Providencia sp. NPDC089768 tRNA-Lys
  231. Providencia sp. NPDC089930 tRNA-Lys
  232. Providencia sp. NPDC089933 tRNA-Lys
  233. Providencia sp. PROV004 tRNA-Lys
  234. Providencia sp. PROV012 tRNA-Lys
  235. Providencia sp. PROV_01 tRNA-Lys
  236. Providencia sp. PROV024 tRNA-Lys
  237. Providencia sp. PROV040 tRNA-Lys
  238. Providencia sp. PROV046 tRNA-Lys
  239. Providencia sp. PROV061 tRNA-Lys
  240. Providencia sp. PROV099 tRNA-Lys
  241. Providencia sp. PROV114 tRNA-Lys
  242. Providencia sp. PROV170 tRNA-Lys
  243. Providencia sp. PROV175 tRNA-Lys
  244. Providencia sp. R1 tRNA-Lys
  245. Providencia sp. R2 tRNA-Lys
  246. Providencia sp. R33 tRNA-Lys
  247. Providencia sp. R3 tRNA-Lys
  248. Providencia xihuensis Providencia sp. SKLX074055 tRNA-Lys
  249. Providencia zhejiangensis Providencia sp. SKLX146130 tRNA-Lys
  250. Providencia sp. SP181 tRNA-Lys
  251. Providencia sp. T47 tRNA-Lys
  252. Providencia sp. tRNA-Lys
  253. Providencia sp. TYF_10 tRNA-Lys
  254. Providencia sp. TYF-12 tRNA-Lys
  255. Providencia sp. wls1948 tRNA-Lys
  256. Providencia sp. wls1949 tRNA-Lys
  257. Providencia stuartii MRSN 2154 tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 3)
  258. Providencia stuartii tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 5)
  259. Providencia stuartii tRNA-Lys
  260. Providencia vermicola tRNA-Lys
  261. Pseudaeromonas paramecii tRNA-Lys
  262. Pseudomonadota bacterium tRNA-Lys
  263. Salmonella enterica subsp. enterica serovar Kandla tRNA-Lys
  264. Salmonella enterica subsp. enterica serovar Rissen tRNA-Lys
  265. Salmonella enterica tRNA-Lys
  266. Samsonia erythrinae tRNA-Lys
  267. Scandinavium sp. tRNA-Lys
  268. Sedimenticolaceae bacterium tRNA-Lys
  269. Serratia aquatilis tRNA-Lys
  270. Serratia oryzae tRNA-Lys
  271. Serratia sp. 25CWL12 tRNA-Lys
  272. Serratia sp. Ag1 tRNA-Lys
  273. Serratia sp. Ag2 tRNA-Lys
  274. Serratia sp. DD3 tRNA-Lys
  275. Serratia sp. HNCC26DJ244 tRNA-Lys
  276. Serratia sp. S1B tRNA-Lys
  277. Serratia sp. UGAL515B_01 tRNA-Lys
  278. Shewanella algae tRNA-Lys
  279. Shigella boydii 3594-74 tRNA-Lys
  280. Shigella boydii 4444-74 tRNA-Lys
  281. Shigella boydii CDC 3083-94 tRNA-Lys (TTT) (tRNA-Lys-TTT-2-1)
  282. Shigella boydii tRNA-Lys
  283. Shigella dysenteriae 225-75 tRNA-Lys
  284. Shigella dysenteriae tRNA-Lys
  285. Shigella flexneri 1485-80 tRNA-Lys
  286. Shigella flexneri K-315 tRNA-Lys
  287. Shigella flexneri tRNA-Lys
  288. Shigella sonnei tRNA-Lys
  289. Shigella sp. FC1056 tRNA-Lys
  290. Shigella sp. FC1544 tRNA-Lys
  291. Shigella sp. FC1567 tRNA-Lys
  292. Shigella sp. FC1661 tRNA-Lys
  293. Shigella sp. FC1708 tRNA-Lys
  294. Shigella sp. FC1737 tRNA-Lys
  295. Shigella sp. FC1882 tRNA-Lys
  296. Shigella sp. FC2117 tRNA-Lys
  297. Shigella sp. FC2125 tRNA-Lys
  298. Shigella sp. FC2175 tRNA-Lys
  299. Shigella sp. FC2383 tRNA-Lys
  300. Shigella sp. FC2531 tRNA-Lys
  301. Shigella sp. FC2541 tRNA-Lys
  302. Shigella sp. FC3196 tRNA-Lys
  303. Shigella sp. PNUSAE202800 tRNA-Lys
  304. Sodalis-like symbiont of Philaenus spumarius tRNA-Lys
  305. Symbiopectobacterium endosymbiont of Pseudoregma panicola tRNA-Lys
  306. Symbiopectobacterium sp. Eva_TO tRNA-Lys
  307. Symbiopectobacterium sp. RP tRNA-Lys
  308. Symbiopectobacterium sp. tRNA-Lys
  309. Tatumella citrea tRNA-Lys
  310. Thiosocius sp. tRNA-Lys
  311. Thorsellia kenyensis tRNA-Lys
  312. Vibrio chanodichtyis tRNA-Lys
  313. Vibrio paracholerae tRNA-Lys
  314. Vibrio paracholerae tRNA-Lys
  315. Vibrio paracholerae 877-163 tRNA-Lys
  316. Vibrio paracholerae 87395 tRNA-Lys
  317. Vibrio cholerae tRNA-Lys
  318. Vibrio cidicii tRNA-Lys
  319. Vibrio fluvialis tRNA-Lys
  320. Vibrio metoecus tRNA-Lys
  321. Vibrio navarrensis tRNA-Lys
  322. Vibrio paracholerae tRNA-Lys
  323. Vibrio sp. 03_296 tRNA-Lys
  324. Vibrio sp. 05-20-BW147 tRNA-Lys
  325. Vibrio sp. AH4 tRNA-Lys
  326. Vibrio sp. CCUG 15886 tRNA-Lys
  327. Vibrio sp. HDW18 tRNA-Lys
  328. Vibrio sp. S234-5 tRNA-Lys
  329. Vibrio vulnificus CladeA-yb158 tRNA-Lys
  330. Vibrio vulnificus CMCP6 tRNA-Lys (TTT) (tRNA-Lys-TTT-2-1, tRNA-Lys-TTT-2-2)
  331. Vibrio vulnificus Env1 tRNA-Lys
  332. Vibrio vulnificus MO6-24/O tRNA-Lys (TTT) (tRNA-Lys-TTT-1-1)
  333. Vibrio vulnificus NBRC 15645 = ATCC 27562 tRNA-Lys
  334. Vibrio vulnificus tRNA-Lys (TTT) (tRNA-Lys-TTT-2-1)
  335. Vibrio vulnificus YJ016 tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 5)
  336. Xenorhabdus aichiensis tRNA-Lys
  337. Xenorhabdus anantnagensis tRNA-Lys
  338. Xenorhabdus beddingii tRNA-Lys
  339. Xenorhabdus bovienii SS-2004 tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 5)
  340. Xenorhabdus bovienii str. feltiae Florida tRNA-Lys
  341. Xenorhabdus bovienii str. feltiae France tRNA-Lys
  342. Xenorhabdus bovienii str. feltiae Moldova tRNA-Lys
  343. Xenorhabdus bovienii str. Intermedium tRNA-Lys
  344. Xenorhabdus bovienii str. Jollieti tRNA-Lys
  345. Xenorhabdus bovienii str. kraussei Becker Underwood tRNA-Lys
  346. Xenorhabdus bovienii str. kraussei Quebec tRNA-Lys
  347. Xenorhabdus bovienii str. oregonense tRNA-Lys
  348. Xenorhabdus bovienii str. puntauvense tRNA-Lys
  349. Xenorhabdus bovienii subsp. africana tRNA-Lys
  350. Xenorhabdus bovienii tRNA-Lys (TTT) (tRNA-Lys-TTT-2-1, tRNA-Lys-TTT-2-2)
  351. Xenorhabdus budapestensis tRNA-Lys
  352. Xenorhabdus cabanillasii JM26 tRNA-Lys
  353. Xenorhabdus doucetiae tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 4)
  354. Xenorhabdus eapokensis tRNA-Lys
  355. Xenorhabdus ehlersii tRNA-Lys
  356. Xenorhabdus griffiniae tRNA-Lys
  357. Xenorhabdus hominickii tRNA-Lys
  358. Xenorhabdus indica tRNA-Lys
  359. Xenorhabdus innexi tRNA-Lys
  360. Xenorhabdus ishibashii tRNA-Lys
  361. Xenorhabdus khoisanae tRNA-Lys
  362. Xenorhabdus kozodoii tRNA-Lys
  363. Xenorhabdus littoralis tRNA-Lys
  364. Xenorhabdus mauleonii tRNA-Lys
  365. Xenorhabdus miraniensis tRNA-Lys
  366. Xenorhabdus nematophila AN6/1 tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 5)
  367. Xenorhabdus nematophila ATCC 19061 tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 5)
  368. Xenorhabdus nematophila F1 tRNA-Lys
  369. Xenorhabdus nematophila str. Anatoliense tRNA-Lys
  370. Xenorhabdus nematophila str. Websteri tRNA-Lys
  371. Xenorhabdus nematophila tRNA-Lys
  372. Xenorhabdus poinarii G6 tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 5)
  373. Xenorhabdus poinarii tRNA-Lys
  374. Xenorhabdus santafensis tRNA-Lys
  375. Xenorhabdus doucetiae tRNA-Lys
  376. Xenorhabdus szentirmaii tRNA-Lys
  377. Xenorhabdus szentirmaii tRNA-Lys
  378. Xenorhabdus sp. BG5 tRNA-Lys
  379. Xenorhabdus szentirmaii tRNA-Lys
  380. Xenorhabdus sp. GDc328 tRNA-Lys
  381. Xenorhabdus sp. IM139775 tRNA-Lys
  382. Xenorhabdus sp. KJ12.1 tRNA-Lys
  383. Xenorhabdus sp. KK7.4 tRNA-Lys
  384. Xenorhabdus szentirmaii tRNA-Lys
  385. Xenorhabdus sp. PB30.3 tRNA-Lys
  386. Xenorhabdus sp. PB61.4 tRNA-Lys
  387. Xenorhabdus sp. PB62.4 tRNA-Lys
  388. Xenorhabdus sp. PR6a tRNA-Lys
  389. Xenorhabdus littoralis Xenorhabdus sp. psl tRNA-Lys
  390. Xenorhabdus bakwenae tRNA-Lys
  391. Xenorhabdus sp. SGI240 tRNA-Lys
  392. Xenorhabdus sp. SGI246 tRNA-Lys
  393. Xenorhabdus sp. SGI 60 tRNA-Lys
  394. Xenorhabdus taiwanensis Xenorhabdus sp. TCT-1 tRNA-Lys
  395. Xenorhabdus sp. TH1 tRNA-Lys
  396. Xenorhabdus sp. TS4 tRNA-Lys
  397. Xenorhabdus lircayensis tRNA-Lys
  398. Xenorhabdus szentirmaii tRNA-Lys
  399. Xenorhabdus stockiae tRNA-Lys
  400. Xenorhabdus szentirmaii DSM 16338 tRNA-Lys
  401. Xenorhabdus szentirmaii tRNA-Lys
  402. Xenorhabdus thuongxuanensis tRNA-Lys
  403. Xenorhabdus vietnamensis tRNA-Lys
  404. Xenorhabdus yunnanensis tRNA-Lys
Relationships

Molecular Relationships

2D structure

Loading 2D structure...