Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bombyx mori (domestic silkworm) bmo-let-7-3p URS000021A029_7091

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bmo-let-7: Bmo-let-7 is a microRNA that is expressed in various tissues of the silkworm, Bombyx mori, and is regulated by ecdysone, a hormone involved in insect development [PMC4222307]. The expression of bmo-let-7 is influenced by the concentration of ecdysone, with higher levels of ecdysone leading to down-regulation of bmo-let-7 [PMC1976426]. The expression profile of bmo-let-7 varies during the development of the silkworm, with higher expression levels observed during certain molting stages [PMC1976426]. The expression of bmo-let-7 is induced by a pulse of ecdysone and may be involved in processes such as cell proliferation, histogenesis, histolysis, organogenesis, and apoptosis [PMC1976426]. Bmo-let-7 is highly expressed in pupae and its expression may be induced by ecdysone in various tissues [PMC1976426]. The expression profile of bmo-let-7 differs among tissues and developmental stages [PMC1976426]. Bmo-let-7 has been identified as a member of the let-7 family in Bombyx mori and its expression has been profiled using Northern blotting [PMC1976426]. Bmo-bantam and bmo-miR31 are other highly abundant miRNAs identified in Bombyx mori [PMC3699532]. A miRNA sponge construct targeting bmo let 7 has been shown to induce developmental arrest by targeting FTZ-F1 and Eip74EF (E74) in the ecdysone pathway [PMC5689003].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGUAUAGCCUGCUAACUUUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications