Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila pseudoobscura pseudoobscura tRNA-Ser (CGA) (tRNA-Ser-CGA-1-1, tRNA-Ser-CGA-1-2) secondary structure diagram

Drosophila pseudoobscura pseudoobscura tRNA-Ser (CGA) (tRNA-Ser-CGA-1-1, tRNA-Ser-CGA-1-2) URS00002085AD_46245

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCAGUCGUGGCCGAGUGGUUAAGGCGUCUGACUCGAAAUCAGAUUCCCUCUGGGAGCGUAGGUUCGAAUCCUACCGGCUGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 96 other species

  1. Aedes aegypti tRNA AAEL018923
  2. Aedes albopictus tRNA tRNA-Ser
  3. Aethina tumida (Small hive beetle) transfer RNA serine (anticodon CGA)
  4. Amyelois transitella tRNA-Ser
  5. Ancistrocerus nigricornis (Potter wasp) misc RNA ENSANRG00000011380.1
  6. Anopheles albimanus (Mosquito) tRNA tRNA-Ser
  7. Anopheles arabiensis tRNA
  8. Anopheles atroparvus tRNA
  9. Anopheles christyi tRNA tRNA-Ser
  10. Anopheles coluzzii (Mosquito) tRNA tRNA-Ser
  11. Anopheles culicifacies (Mosquito) tRNA tRNA-Ser
  12. Anopheles darlingi (American malaria mosquito) tRNA Serine
  13. Anopheles dirus tRNA tRNA-Ser
  14. Anopheles epiroticus (Mosquito) tRNA tRNA-Ser
  15. Anopheles farauti (Mosquito) tRNA tRNA-Ser
  16. Anopheles funestus tRNA-Ser for anticodon CGA
  17. Anopheles gambiae tRNA tRNA-Ser
  18. Anopheles gambiae str. PEST tRNA-Ser (CGA) (tRNA-Ser-CGA-1 1 to 8)
  19. Anopheles melas (Mosquito) tRNA tRNA-Ser
  20. Anopheles merus (Mosquito) tRNA tRNA-Ser
  21. Anopheles minimus tRNA
  22. Anopheles quadriannulatus (Mosquito) tRNA tRNA-Ser
  23. Anopheles sinensis (Mosquito) tRNA tRNA-Ser
  24. Anopheles stephensi (Asian malaria mosquito) tRNA tRNA-Ser
  25. Anthonomus grandis grandis transfer RNA serine (anticodon CGA)
  26. Aphidius gifuensis tRNA-Ser
  27. Aromia moschata tRNA-Ser
  28. Athalia rosae (Coleseed sawfly) misc RNA ENSAEAG00005013508.1
  29. Bactrocera dorsalis tRNA-Ser
  30. Bactrocera latifrons tRNA-Ser
  31. Bactrocera tryoni (Queensland fruitfly) tRNA-Ser
  32. Bicyclus anynana (Squinting bush brown) tRNA-Ser
  33. Bombyx mandarina (Wild silkworm) tRNA-Ser
  34. Bombyx mori tRNA-Ser (CGA) (tRNA-Ser-CGA-1 1 to 3)
  35. Ceratitis capitata (Mediterranean fruit fly) tRNA-Ser
  36. Culex quinquefasciatus tRNA tRNA-Ser
  37. Danaus plexippus plexippus tRNA
  38. Drosophila ananassae tRNA-Ser (CGA) (tRNA-Ser-CGA-2 1 to 4)
  39. Drosophila busckii tRNA
  40. Drosophila erecta tRNA-Ser (CGA) (tRNA-Ser-CGA-1 1 to 4)
  41. Drosophila ficusphila tRNA
  42. Drosophila grimshawi tRNA-Ser (CGA) (tRNA-Ser-CGA-1 1 to 3)
  43. Drosophila guanche tRNA.Ser
  44. Drosophila gunungcola tRNA-OTHER
  45. Drosophila melanogaster (fruit fly) transfer RNA:Serine-CGA 1-4 (Dmel_CR30224, Dmel_CR32608, Dmel_CR32621, Dmel_CR32623)
  46. Drosophila mojavensis tRNA-Ser (CGA) (tRNA-Ser-CGA-1 1 to 3)
  47. Drosophila persimilis tRNA-Ser (CGA) (tRNA-Ser-CGA-1 1 to 4)
  48. Drosophila sechellia tRNA-Ser (CGA) (tRNA-Ser-CGA-1 1 to 4)
  49. Drosophila simulans tRNA-Ser (CGA) (tRNA-Ser-CGA-1 1 to 4)
  50. Drosophila virilis tRNA-Ser (CGA) (tRNA-Ser-CGA-1 1 to 4)
  51. Drosophila yakuba tRNA-Ser (CGA) (tRNA-Ser-CGA-1 1 to 5)
  52. Eumeta japonica tRNA-Ser
  53. Galleria mellonella (Greater wax moth) tRNA-Ser
  54. Glossina austeni (Tsetse fly) tRNA tRNA-Ser
  55. Glossina brevipalpis (Tsetse fly) tRNA tRNA-Ser
  56. Glossina fuscipes fuscipes tRNA
  57. Glossina morsitans morsitans tRNA tRNA-Ser
  58. Glossina pallidipes tRNA tRNA-Ser
  59. Glossina palpalis gambiensis tRNA tRNA-Ser
  60. Glyphotaelius pellucidus (Caddisflies) misc RNA ENSGPLG00000014649.1
  61. Heliconius melpomene (Postman butterfly) tRNA HMEL013648
  62. Helicoverpa armigera (Cotton bollworm) transfer RNA serine (anticodon CGA)
  63. Helicoverpa zea (Corn earworm) tRNA-Ser
  64. Hermetia illucens tRNA-Ser
  65. Leguminivora glycinivorella tRNA-Ser
  66. Limnephilus lunatus (Caddisflies) misc RNA ENSLLSG00015015145.1
  67. Limnephilus marmoratus (Caddisflies) misc RNA ENSLMMG00005015643.1
  68. Limnephilus rhombicus (Caddisflies) misc RNA ENSLRHG00005015932.1
  69. Lucilia cuprina tRNA-Ser for anticodon CGA
  70. Manduca sexta tRNA-Ser
  71. Melitaea cinxia misc RNA ENSMCXG00005023267.1
  72. Molorchus minor tRNA-Ser
  73. Musca domestica (House fly) tRNA MDOA014826
  74. Neodiprion lecontei (Redheaded pine sawfly) tRNA-Ser
  75. Neodiprion pinetum (White pine sawfly) tRNA-Ser
  76. Operophtera brumata (winter moth) tRNA
  77. Papilio machaon tRNA
  78. Papilio xuthus tRNA
  79. Pararge aegeria tRNA-Ser (CGA) (tRNA-Ser-CGA-1 1 to 4)
  80. Pectinophora gossypiella transfer RNA serine (anticodon CGA)
  81. Plutella xylostella (diamondback moth) tRNA-Ser
  82. Polistes canadensis tRNA-Ser
  83. Polistes dominula (European paper wasp) tRNA-Ser
  84. Polistes fuscatus (Common paper wasp) tRNA-Ser
  85. Rhagoletis pomonella tRNA-Ser
  86. Schistocerca americana (American grasshopper) tRNA-Ser
  87. Schistocerca cancellata (South American locust) transfer RNA serine (anticodon CGA)
  88. Schistocerca gregaria (Grasshoppers) transfer RNA serine (anticodon CGA)
  89. Schistocerca nitens (Vagrant locust) transfer RNA serine (anticodon CGA)
  90. Schistocerca piceifrons (Central American locust) tRNA-Ser
  91. Schistocerca serialis cubense (Grasshoppers) transfer RNA serine (anticodon CGA)
  92. Sitophilus oryzae (Rice weevil) tRNA-Ser
  93. Spodoptera frugiperda tRNA-Ser (CGA) (tRNA-Ser-CGA-2-1, tRNA-Ser-CGA-2-2)
  94. Stomoxys calcitrans tRNA-Ser
  95. Tribolium castaneum tRNA-Ser for anticodon CGA
  96. Zerene cesonia tRNA-Ser
2D structure Publications