Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Erinaceus europaeus tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 3) secondary structure diagram

Erinaceus europaeus tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 3) URS00002064F6_9365

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUUUCCGUAGUGUAGUGGUUAUCACGUUCGCCUCACACGCGAAAGGUCCCCGGUUCGAAACCGGGCGGAAACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 85 other species

  1. Ailuropoda melanoleuca tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 8)
  2. Albula glossodonta tRNA-OTHER
  3. Albula goreensis tRNA-Val
  4. Alosa alosa tRNA-Val
  5. Ameiurus melas tRNA-Val
  6. Anguilla anguilla tRNA-Val
  7. Ataeniobius toweri tRNA-Val
  8. Balaenoptera acutorostrata scammoni tRNA-Val (CAC) (tRNA-Val-CAC-1-1, tRNA-Val-CAC-1-2)
  9. Bos taurus tRNA-Val (CAC) (tRNA-Val-CAC-2 1 to 7)
  10. Callithrix jacchus tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 5)
  11. Callorhinchus milii tRNA-Val (CAC) (tRNA-Val-CAC-1-1)
  12. Canis lupus familiaris tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 6)
  13. Carlito syrichta tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 3)
  14. Cavia porcellus tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 4)
  15. Ceratotherium simum simum tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 4)
  16. Characodon lateralis tRNA-Val
  17. Chlorocebus sabaeus tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 4)
  18. Choloepus hoffmanni tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 3)
  19. Crenichthys baileyi tRNA-Val
  20. Cricetulus griseus tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 5)
  21. Dallia pectoralis tRNA-OTHER
  22. Danionella translucida tRNA-Val
  23. Danio rerio tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 5)
  24. Dasypus novemcinctus tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 5)
  25. Dipodomys ordii tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 4)
  26. Echinops telfairi tRNA-Val (CAC) (tRNA-Val-CAC-1-1, tRNA-Val-CAC-1-2)
  27. Eptesicus nilssonii tRNA-Val
  28. Equus caballus tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 9)
  29. Felis catus tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 10)
  30. Gadus morhua tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 9)
  31. Gorilla gorilla gorilla tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 6)
  32. Heterocephalus glaber tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 4)
  33. Hippoglossus stenolepis (Pacific halibut) tRNA-Val
  34. Homo sapiens (human) tRNA-Val (anticodon CAC) 1-1 (TRV-CAC1 1 to 7)
  35. Ictidomys tridecemlineatus tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 4)
  36. Larimichthys crocea tRNA
  37. Loxodonta africana tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 10)
  38. Macaca mulatta tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 4, tRNA-Val-CAC-1-6)
  39. Marmota monax (woodchuck) tRNA.Val
  40. Megalops atlanticus (tarpon) tRNA-Val
  41. Merluccius polli tRNA-Val
  42. Microcebus murinus tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 5)
  43. Monodelphis domestica tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 7)
  44. Mus caroli tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 6)
  45. Mus musculus castaneus tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 5)
  46. Mus musculus domesticus tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 5)
  47. Mus musculus musculus tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 5)
  48. Mus musculus tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 5, tRNA-Val-CAC-2 1 to 5)
  49. Mus pahari tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 4)
  50. Mus spretus tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 5)
  51. Mustela putorius furo tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 4)
  52. Myotis lucifugus tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 4)
  53. Nomascus leucogenys tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 5)
  54. Notamacropus eugenii tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 4)
  55. Nothobranchius furzeri tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 4)
  56. Ochotona princeps tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 6)
  57. Oreochromis niloticus tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 8)
  58. Ornithorhynchus anatinus tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 5)
  59. Oryctolagus cuniculus tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 11)
  60. Oryzias latipes tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 4)
  61. Otolemur garnettii tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 3)
  62. Ovis aries tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 9)
  63. Pangasianodon gigas (Mekong giant catfish) tRNA-Val
  64. Pangasianodon hypophthalmus tRNA-Val
  65. Pangasius djambal tRNA-Val
  66. Pan troglodytes tRNA-Val (CAC) (tRNA-Val-CAC-2 2 to 6)
  67. Papio anubis tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 7)
  68. Perca flavescens (yellow perch) tRNA-Val
  69. Perca fluviatilis tRNA-Val
  70. Petromyzon marinus tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 28)
  71. Pleuronectes platessa tRNA-Val
  72. Poecilia formosa tRNA
  73. Pongo abelii tRNA-Val (CAC) (tRNA-Val-CAC-2 1 to 3, tRNA-Val-CAC-2-5, tRNA-Val-CAC-2-6)
  74. Procavia capensis tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 7)
  75. Rattus norvegicus tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 3)
  76. Saimiri boliviensis boliviensis tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 3)
  77. Sarcophilus harrisii tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 5)
  78. Scleropages formosus tRNA
  79. Sorex araneus tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 4)
  80. Sus scrofa tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 5)
  81. Takifugu rubripes tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 3, tRNA-Val-CAC-1 5 to 10, tRNA-Val-CAC-1-12, tRNA-Val-CAC-1 14 to 20)
  82. Trichechus manatus latirostris tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 4)
  83. Tupaia chinensis (Chinese tree shrew) tRNA
  84. Tursiops truncatus tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 4)
  85. Vicugna pacos tRNA-Val (CAC) (tRNA-Val-CAC-1 1 to 5)
2D structure Publications