Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C tRNA-Ala secondary structure diagram

Saccharomyces cerevisiae S288C tRNA-Ala URS00001FC1C3_559292

Automated summary: This tRNA sequence is 76 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 2 databases (ENA, SGD). Described in 21 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (tRNA, RF00005). Found in the Saccharomyces cerevisiae S288C reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GGGGUUAUAGUUAAAUUUGGUAGAACGACUGCGUUGCAUGCAUUUAAUAUGAGUUCAAGUCUCAUUAACUCCAAUA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 98 other species

    1. Saccharomyces cerevisiae (baker's yeast) tRNA-Ala
    2. Saccharomyces cerevisiae Kyokai no. 7 tRNA-Ala
    3. Saccharomyces cerevisiae PE-2 tRNA-Ala
    4. Saccharomyces cerevisiae YJM1078 tRNA-Ala
    5. Saccharomyces cerevisiae YJM1083 tRNA-Ala
    6. Saccharomyces cerevisiae YJM1129 tRNA-Ala
    7. Saccharomyces cerevisiae YJM1133 tRNA-Ala
    8. Saccharomyces cerevisiae YJM1190 tRNA-Ala
    9. Saccharomyces cerevisiae YJM1199 tRNA-Ala
    10. Saccharomyces cerevisiae YJM1202 tRNA-Ala
    11. Saccharomyces cerevisiae YJM1208 tRNA-Ala
    12. Saccharomyces cerevisiae YJM1242 tRNA-Ala
    13. Saccharomyces cerevisiae YJM1244 tRNA-Ala
    14. Saccharomyces cerevisiae YJM1248 tRNA-Ala
    15. Saccharomyces cerevisiae YJM1250 tRNA-Ala
    16. Saccharomyces cerevisiae YJM1252 tRNA-Ala
    17. Saccharomyces cerevisiae YJM1273 tRNA-Ala
    18. Saccharomyces cerevisiae YJM1304 tRNA-Ala
    19. Saccharomyces cerevisiae YJM1307 tRNA-Ala
    20. Saccharomyces cerevisiae YJM1311 tRNA-Ala
    21. Saccharomyces cerevisiae YJM1326 tRNA-Ala
    22. Saccharomyces cerevisiae YJM1332 tRNA-Ala
    23. Saccharomyces cerevisiae YJM1336 tRNA-Ala
    24. Saccharomyces cerevisiae YJM1338 tRNA-Ala
    25. Saccharomyces cerevisiae YJM1341 tRNA-Ala
    26. Saccharomyces cerevisiae YJM1342 tRNA-Ala
    27. Saccharomyces cerevisiae YJM1355 tRNA-Ala
    28. Saccharomyces cerevisiae YJM1356 tRNA-Ala
    29. Saccharomyces cerevisiae YJM1381 tRNA-Ala
    30. Saccharomyces cerevisiae YJM1383 tRNA-Ala
    31. Saccharomyces cerevisiae YJM1385 tRNA-Ala
    32. Saccharomyces cerevisiae YJM1386 tRNA-Ala
    33. Saccharomyces cerevisiae YJM1387 tRNA-Ala
    34. Saccharomyces cerevisiae YJM1388 tRNA-Ala
    35. Saccharomyces cerevisiae YJM1389 tRNA-Ala
    36. Saccharomyces cerevisiae YJM1399 tRNA-Ala
    37. Saccharomyces cerevisiae YJM1400 tRNA-Ala
    38. Saccharomyces cerevisiae YJM1401 tRNA-Ala
    39. Saccharomyces cerevisiae YJM1402 tRNA-Ala
    40. Saccharomyces cerevisiae YJM1415 tRNA-Ala
    41. Saccharomyces cerevisiae YJM1417 tRNA-Ala
    42. Saccharomyces cerevisiae YJM1418 tRNA-Ala
    43. Saccharomyces cerevisiae YJM1419 tRNA-Ala
    44. Saccharomyces cerevisiae YJM1433 tRNA-Ala
    45. Saccharomyces cerevisiae YJM1434 tRNA-Ala
    46. Saccharomyces cerevisiae YJM1439 tRNA-Ala
    47. Saccharomyces cerevisiae YJM1443 tRNA-Ala
    48. Saccharomyces cerevisiae YJM1444 tRNA-Ala
    49. Saccharomyces cerevisiae YJM1447 tRNA-Ala
    50. Saccharomyces cerevisiae YJM1450 tRNA-Ala
    51. Saccharomyces cerevisiae YJM1460 tRNA-Ala
    52. Saccharomyces cerevisiae YJM1463 tRNA-Ala
    53. Saccharomyces cerevisiae YJM1477 tRNA-Ala
    54. Saccharomyces cerevisiae YJM1478 tRNA-Ala
    55. Saccharomyces cerevisiae YJM1479 tRNA-Ala
    56. Saccharomyces cerevisiae YJM1526 tRNA-Ala
    57. Saccharomyces cerevisiae YJM1527 tRNA-Ala
    58. Saccharomyces cerevisiae YJM1549 tRNA-Ala
    59. Saccharomyces cerevisiae YJM1573 tRNA-Ala
    60. Saccharomyces cerevisiae YJM1574 tRNA-Ala
    61. Saccharomyces cerevisiae YJM1592 tRNA-Ala
    62. Saccharomyces cerevisiae YJM1615 tRNA-Ala
    63. Saccharomyces cerevisiae YJM189 tRNA-Ala
    64. Saccharomyces cerevisiae YJM193 tRNA-Ala
    65. Saccharomyces cerevisiae YJM195 tRNA-Ala
    66. Saccharomyces cerevisiae YJM244 tRNA-Ala
    67. Saccharomyces cerevisiae YJM248 tRNA-Ala
    68. Saccharomyces cerevisiae YJM270 tRNA-Ala
    69. Saccharomyces cerevisiae YJM271 tRNA-Ala
    70. Saccharomyces cerevisiae YJM320 tRNA-Ala
    71. Saccharomyces cerevisiae YJM326 tRNA-Ala
    72. Saccharomyces cerevisiae YJM428 tRNA-Ala
    73. Saccharomyces cerevisiae YJM450 tRNA-Ala
    74. Saccharomyces cerevisiae YJM451 tRNA-Ala
    75. Saccharomyces cerevisiae YJM453 tRNA-Ala
    76. Saccharomyces cerevisiae YJM456 tRNA-Ala
    77. Saccharomyces cerevisiae YJM470 tRNA-Ala
    78. Saccharomyces cerevisiae YJM541 tRNA-Ala
    79. Saccharomyces cerevisiae YJM554 tRNA-Ala
    80. Saccharomyces cerevisiae YJM555 tRNA-Ala
    81. Saccharomyces cerevisiae YJM627 tRNA-Ala
    82. Saccharomyces cerevisiae YJM681 tRNA-Ala
    83. Saccharomyces cerevisiae YJM682 tRNA-Ala
    84. Saccharomyces cerevisiae YJM683 tRNA-Ala
    85. Saccharomyces cerevisiae YJM689 tRNA-Ala
    86. Saccharomyces cerevisiae YJM693 tRNA-Ala
    87. Saccharomyces cerevisiae YJM789 tRNA-Ala
    88. Saccharomyces cerevisiae YJM969 tRNA-Ala
    89. Saccharomyces cerevisiae YJM972 tRNA-Ala
    90. Saccharomyces cerevisiae YJM975 tRNA-Ala
    91. Saccharomyces cerevisiae YJM978 tRNA-Ala
    92. Saccharomyces cerevisiae YJM981 tRNA-Ala
    93. Saccharomyces cerevisiae YJM984 tRNA-Ala
    94. Saccharomyces cerevisiae YJM987 tRNA-Ala
    95. Saccharomyces cerevisiae YJM990 tRNA-Ala
    96. Saccharomyces cerevisiae YJM993 tRNA-Ala
    97. Saccharomyces cerevisiae YJM996 tRNA-Ala
    98. Saccharomyces mikatae tRNA-Ala
    2D structure New