Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila elegans (Fruit fly) tRNA-Arg secondary structure diagram

Drosophila elegans (Fruit fly) tRNA-Arg URS00001F62D0_30023

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GACCGUGUGGCCUAAAGGAUAAGGCGUCGGACUUCGAAUCCGAAGAUUGCAGGUUCGAGUCCUGUCACGGUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 27 other species

  1. Drosophila ananassae tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
  2. Drosophila biarmipes (Fruit fly) transfer RNA arginine (anticodon UCG)
  3. Drosophila bipectinata (Fruit fly) tRNA-Arg
  4. Drosophila erecta tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  5. Drosophila eugracilis (Fruit fly) tRNA-Arg
  6. Drosophila ficusphila (Fruit fly) tRNA-Arg
  7. Drosophila guanche (Fruit fly) tRNA-Arg
  8. Drosophila gunungcola (Fruit fly) transfer RNA arginine (anticodon UCG)
  9. Drosophila kikkawai (Fruit fly) tRNA-Arg
  10. Drosophila mauritiana (Fruit fly) tRNA-Arg
  11. Drosophila melanogaster transfer RNA:Arginine-TCG 4-1 (Dmel_CR31593)
  12. Drosophila miranda (Fruit fly) tRNA-Arg
  13. Drosophila obscura (Fruit fly) tRNA-Arg
  14. Drosophila persimilis tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
  15. Drosophila pseudoobscura (Fruit fly) tRNA-Arg
  16. Drosophila pseudoobscura pseudoobscura tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
  17. Drosophila rhopaloa (Fruit fly) tRNA-Arg
  18. Drosophila santomea (Fruit fly) tRNA-Arg
  19. Drosophila sechellia tRNA-Arg (TCG) (tRNA-Arg-TCG-4-1)
  20. Drosophila simulans tRNA-Arg (TCG) (tRNA-Arg-TCG-4-1)
  21. Drosophila subobscura (Fruit fly) tRNA-Arg
  22. Drosophila subpulchrella (Fruit fly) tRNA-Arg
  23. Drosophila suzukii (Fruit fly) tRNA-Arg
  24. Drosophila takahashii (Fruit fly) tRNA-Arg
  25. Drosophila teissieri (Fruit fly) tRNA-Arg
  26. Drosophila willistoni tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
  27. Drosophila yakuba tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
Relationships

Molecular Relationships

2D structure

Loading 2D structure...