Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) microRNA ssc-mir-136 precursor URS00001F52D0_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-136: Ssc-mir-136 is a microRNA that has been shown to be down-regulated in certain conditions, but the exact regulatory pathway is still unclear [PMC7923233]. In F18-sensitive piglets, ssc-mir-136 was significantly up-regulated [PMC5093996]. It has been found to target the MUC4 gene [PMC5093996]. Ssc-mir-136 has also been found to target the NA and NP genes of SIV-H1N1/2009 [PMC5412334]. In addition, ssc-mir-136 was highly expressed in mpiPSCs but had low expression in hpiPSCs [PMC4934789]. Ssc-mir-136 is one of the annotated miRNAs in the porcine Dik1-Dio3 region [PMC4934789]. It has also been found to be down-regulated in skeletal muscle growth affected by maternal low protein diets [PMC5075561]. References: - [PMC7923233]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7923233/ - [PMC5093996]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5093996/ - [PMC5412334]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5412334/ - [PMC4934789]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4934789/ - [ PMC5075561]: https://www.ncbi.nlm.nih.gov/pmc/articles/ PMC5075561/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGCCCUCGGAGGACUCCAUUUGUUUUGAUGAUGGAUUCUUACGCUCCAUCAUCGUCUCAAAUGAGUCUUCAGAGGGUUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

Publications