v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-2828771 URS00001F4670_8364

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GAGGGUUGGGUGGAGGCUCUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

  1. Homo sapiens (human) hsa-miR-296-3p
  2. Macaca mulatta mml-miR-296-3p
  3. Mus musculus (house mouse) mmu-miR-296-3p
  4. Pan troglodytes ptr-miR-296
  5. Pongo pygmaeus (Bornean orangutan) ppy-miR-296-3p
  6. Rattus norvegicus (Norway rat) rno-miR-296-3p