v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila melanogaster (fruit fly) transfer RNA:Methionine-CAT 1-1 (Dmel_CR30255, Dmel_CR31310, Dmel_CR32153, Dmel_CR32357, Dmel_CR32844) secondary structure diagram

Drosophila melanogaster (fruit fly) transfer RNA:Methionine-CAT 1-1 (Dmel_CR30255, Dmel_CR31310, Dmel_CR32153, Dmel_CR32357, Dmel_CR32844) URS00001F2F77_7227

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCCUCGGUGGCGCAGUUGGCAGCGCGUAAGUCUCAUAAUCUUAAGGUCGUGAGUUCGAGCCUCACCCGGGGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Drosophila ananassae tRNA-Met (CAT) (tRNA-Met-CAT-1 1 to 6)
  2. Drosophila busckii tRNA
  3. Drosophila erecta tRNA-Met (CAT) (tRNA-Met-CAT-1 1 to 4)
  4. Drosophila ficusphila tRNA
  5. Drosophila grimshawi tRNA-Met (CAT) (tRNA-Met-CAT-1 1 to 3)
  6. Drosophila guanche tRNA.Met
  7. Drosophila gunungcola tRNA-OTHER
  8. Drosophila mojavensis tRNA-Met (CAT) (tRNA-Met-CAT-1-1, tRNA-Met-CAT-1-2)
  9. Drosophila persimilis tRNA-Met (CAT) (tRNA-Met-CAT-1 1 to 3)
  10. Drosophila pseudoobscura pseudoobscura tRNA-Met (CAT) (tRNA-Met-CAT-1 1 to 3)
  11. Drosophila sechellia tRNA-Met (CAT) (tRNA-Met-CAT-1 1 to 5)
  12. Drosophila simulans tRNA-Met (CAT) (tRNA-Met-CAT-1 1 to 5)
  13. Drosophila virilis tRNA-Met (CAT) (tRNA-Met-CAT-1 1 to 3)
  14. Drosophila willistoni tRNA-Met (CAT) (tRNA-Met-CAT-1 1 to 8)
  15. Drosophila yakuba tRNA-Met (CAT) (tRNA-Met-CAT-1 1 to 7)
  16. Glyphotaelius pellucidus (Caddisflies) misc RNA ENSGPLG00000014614.1
  17. Limnephilus lunatus (Caddisflies) misc RNA ENSLLSG00015015136.1
  18. Limnephilus rhombicus (Caddisflies) misc RNA ENSLRHG00005015902.1
 2D structure Publications