Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Trachymyrmex zeteki tRNA secondary structure diagram

Trachymyrmex zeteki tRNA URS00001EDB84_64791

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGGAUAUAGCUCAGUGGUAGAGCAUUCGACUGCAGAUCGAGAGGUCCCCGGUUCAAACCCGGGUGUCCCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 127 other species

  1. Acanthoscelides obtectus hypothetical protein
  2. Acromyrmex echinatior (Panamanian leaf-cutter ant) tRNA-Cys
  3. Aethina tumida (Small hive beetle) transfer RNA cysteine (anticodon GCA)
  4. Amblyteles armatorius (Ichneumon Wasp) misc RNA ENSAAYG00000011536.1
  5. Amyelois transitella (Naval orange worm) tRNA-Cys
  6. Ancistrocerus nigricornis (Potter wasp) misc RNA ENSANRG00000007744.1
  7. Anthonomus grandis grandis (Boll weevil) transfer RNA cysteine (anticodon GCA)
  8. Apis dorsata tRNA-Cys
  9. Apis florea tRNA-Cys
  10. Apis mellifera tRNA-Cys (GCA) (tRNA-Cys-GCA-2-1)
  11. Aromia moschata tRNA-Cys
  12. Athalia rosae misc RNA ENSAEAG00005013504.1
  13. Atta cephalotes (Leaf-cutter ant) tRNA LOC105616964-1
  14. Atta colombica tRNA
  15. Bactrocera dorsalis tRNA-Cys
  16. Bactrocera latifrons (Solanum fruit fly) tRNA-Cys
  17. Bactrocera tryoni (Queensland fruitfly) tRNA-Cys
  18. Bicyclus anynana tRNA-Cys
  19. Biomphalaria glabrata (Bloodfluke planorb) tRNA tRNA-Cys
  20. Biomphalaria pfeifferi tRNA-Cys
  21. Bombus huntii (Hunt's bumblebee) transfer RNA cysteine (anticodon GCA)
  22. Bombus terrestris tRNA LOC110120219
  23. Bombus vancouverensis nearcticus (Montane Bumble Bee) tRNA-Cys
  24. Bombyx mandarina (Wild silkworm) tRNA-Cys
  25. Bombyx mori tRNA-Cys (GCA) (tRNA-Cys-GCA-1 1 to 4)
  26. Caerostris extrusa tRNA-Cys
  27. Callosobruchus analis hypothetical protein
  28. Callosobruchus chinensis (azuki bean weevil) hypothetical protein
  29. Camponotus floridanus tRNA-Cys
  30. Cataglyphis hispanica (Desert ant) transfer RNA cysteine (anticodon GCA)
  31. Ceratitis capitata tRNA-Cys
  32. Chelonus insularis tRNA-Cys
  33. Clytia hemisphaerica tRNA-Cys for anticodon GCA
  34. Copidosoma floridanum tRNA-Cys
  35. Culex quinquefasciatus tRNA tRNA-Cys
  36. Cyphomyrmex costatus tRNA
  37. Danaus plexippus plexippus tRNA
  38. Daphnia galeata transfer RNA
  39. Dendroctonus ponderosae tRNA-Cys
  40. Diabrotica virgifera virgifera (Western corn rootworm) tRNA-Cys
  41. Diaphorina citri (Asian citrus psyllid) tRNA
  42. Diuraphis noxia tRNA-Cys
  43. Dreissena polymorpha (Zebra mussle) transfer RNA cysteine (anticodon GCA)
  44. Drosophila ananassae tRNA-Cys (GCA) (tRNA-Cys-GCA-3 1 to 4)
  45. Drosophila busckii tRNA
  46. Drosophila erecta tRNA-Cys (GCA) (tRNA-Cys-GCA-2 1 to 4)
  47. Drosophila ficusphila tRNA
  48. Drosophila grimshawi tRNA-Cys (GCA) (tRNA-Cys-GCA-3 1 to 4)
  49. Drosophila guanche tRNA.Cys
  50. Drosophila gunungcola tRNA-OTHER
  51. Drosophila melanogaster transfer RNA:Cysteine-GCA 1-4 (Dmel_CR32286-32289)
  52. Drosophila mojavensis tRNA-Cys (GCA) (tRNA-Cys-GCA-2 1 to 4)
  53. Drosophila persimilis tRNA-Cys (GCA) (tRNA-Cys-GCA-3 1 to 5)
  54. Drosophila pseudoobscura pseudoobscura tRNA-Cys (GCA) (tRNA-Cys-GCA-4 1 to 5)
  55. Drosophila sechellia tRNA-Cys (GCA) (tRNA-Cys-GCA-2 1 to 3)
  56. Drosophila simulans tRNA-Cys (GCA) (tRNA-Cys-GCA-2 1 to 4)
  57. Drosophila virilis tRNA-Cys (GCA) (tRNA-Cys-GCA-2 1 to 6)
  58. Drosophila willistoni tRNA-Cys (GCA) (tRNA-Cys-GCA-1 1 to 5)
  59. Drosophila yakuba tRNA-Cys (GCA) (tRNA-Cys-GCA-2 1 to 4)
  60. Dufourea novaeangliae tRNA-Cys
  61. Eufriesea mexicana tRNA-Cys
  62. Eumeta japonica tRNA-Cys
  63. Exocentrus adspersus tRNA-Cys
  64. Galleria mellonella tRNA-Cys
  65. Glossina austeni (Tsetse fly) tRNA tRNA-Cys
  66. Glossina brevipalpis (Tsetse fly) tRNA tRNA-Cys
  67. Glossina fuscipes fuscipes tRNA
  68. Glossina morsitans morsitans (Tsetse fly) tRNA tRNA-Cys
  69. Glossina pallidipes (Tsetse fly) tRNA tRNA-Cys
  70. Glossina palpalis gambiensis tRNA tRNA-Cys
  71. Glyphotaelius pellucidus (Caddisflies) misc RNA ENSGPLG00000014632.1
  72. Harpegnathos saltator (Indian jumping ant) tRNA-Cys
  73. Heliconius melpomene (Postman butterfly) tRNA HMEL013649
  74. Helicoverpa armigera (Cotton bollworm) transfer RNA cysteine (anticodon GCA)
  75. Helicoverpa zea (Corn earworm) tRNA-Cys
  76. Hermetia illucens tRNA-Cys
  77. Hydra vulgaris tRNA-Cys
  78. Ichneumon xanthorius (Ichneumon Wasp) misc RNA ENSIXAG00005006371.1
  79. Lasius niger tRNA
  80. Leguminivora glycinivorella tRNA-Cys
  81. Leptinotarsa decemlineata tRNA-Cys
  82. Limnephilus lunatus (Caddisflies) misc RNA ENSLLSG00015015429.1
  83. Limnephilus marmoratus (Caddisflies) misc RNA ENSLMMG00005016280.1
  84. Limnephilus rhombicus (Caddisflies) misc RNA ENSLRHG00005015928.1
  85. Linepithema humile (Argentine ant) tRNA-Cys
  86. Lucilia cuprina (Australian sheep blowfly) tRNA-Cys for anticodon GCA
  87. Lytechinus variegatus (Green sea urchin) tRNA-Cys
  88. Manduca sexta (Tobacco hornworm) tRNA-Cys
  89. Megachile rotundata (Alfalfa leafcutting bee) tRNA-Cys
  90. Megaselia scalaris tRNA-Cys for anticodon GCA
  91. Melitaea cinxia misc RNA ENSMCXG00005023446.1
  92. Molorchus minor tRNA-Cys
  93. Monomorium pharaonis tRNA-Cys
  94. Musca domestica tRNA MDOA001536
  95. Nasonia vitripennis tRNA-Cys
  96. Neodiprion lecontei (Redheaded pine sawfly) tRNA-Cys
  97. Neodiprion pinetum tRNA-Cys
  98. Nilaparvata lugens tRNA-Cys
  99. Octopus sinensis (East Asian common octopus) tRNA-Cys
  100. Oikopleura dioica tRNA
  101. Ooceraea biroi tRNA-Cys
  102. Operophtera brumata (winter moth) tRNA
  103. Oryctes borbonicus tRNA
  104. Papilio machaon tRNA
  105. Papilio xuthus tRNA
  106. Pararge aegeria tRNA-Cys (GCA) (tRNA-Cys-GCA-1 1 to 5)
  107. Patiria miniata (Bat star starfish) tRNA-Cys
  108. Pectinophora gossypiella (Pink bollworm) transfer RNA cysteine (anticodon GCA)
  109. Plutella xylostella (diamondback moth) tRNA-Cys
  110. Polistes canadensis (Red paper wasp) tRNA-Cys
  111. Polistes dominula tRNA-Cys
  112. Polistes fuscatus (Common paper wasp) tRNA-Cys
  113. Pomacea canaliculata tRNA-Cys
  114. Rhagoletis pomonella (Apple magot fly) tRNA-Cys
  115. Rhamnusium bicolor tRNA-OTHER
  116. Sitophilus oryzae tRNA-Cys
  117. Solenopsis invicta (red fire ant) tRNA
  118. Spodoptera frugiperda tRNA-Cys (GCA) (tRNA-Cys-GCA-1 1 to 8)
  119. Stomoxys calcitrans tRNA-Cys
  120. Thrips palmi (Melon Thrips) tRNA-Cys
  121. Trachymyrmex cornetzi tRNA
  122. Tribolium castaneum tRNA-Cys for anticodon GCA
  123. Trichomalopsis sarcophagae tRNA
  124. Varroa destructor tRNA-Cys
  125. Varroa jacobsoni (Varroa mite) tRNA-Cys
  126. Venturia canescens tRNA-Cys
  127. Zerene cesonia tRNA-Cys
2D structure Publications