Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0294391_df_nrg secondary structure diagram

Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0294391_df_nrg URS00001EB815_46245

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAUCACAGCCAGCUUUGAUGGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Cochliomyia hominivorax mature cho-miR-2c
  2. Cochliomyia macellaria mature cma-miR-2c
  3. Drosophila ananassae dan-miR-2c
  4. Drosophila erecta der-miR-2c
  5. Drosophila grimshawi dgr-miR-2c
  6. Drosophila melanogaster (fruit fly) dme-miR-2c-3p
  7. Drosophila mojavensis dmo-miR-2c
  8. Drosophila persimilis dpe-miR-2c
  9. Drosophila pseudoobscura dps-miR-2c
  10. Drosophila sechellia dse-miR-2c
  11. Drosophila simulans dsi-miR-2c
  12. Drosophila virilis dvi-miR-2c-3p
  13. Drosophila willistoni dwi-miR-2c
  14. Drosophila yakuba dya-miR-2c
Relationships

Molecular Relationships

2D structure

Loading 2D structure...