Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa (Asian cultivated rice) osa-miR156l-5p URS00001E3E29_4530

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

osa-miR156l-5p: Osa-mir156l-5p is a miRNA that is involved in various biological processes in plants. It has been found to play a role in the regulation of reactive oxygen species (ROS)-signaling events by suppressing the transcription of POD and SOD genes [PMC7645692]. In the context of IR-IR56-BPH interactions, the expression of osa-mir156l-5p was downregulated, leading to the upregulated expression of its targets, including OsSPL2 (LOC_Os01g69830) [PMC7645692]. This upregulation of osa-mir156l-5p and its targets might have contributed to the ability of IR56-BPH to overcome rice resistance [PMC7645692]. Additionally, osa-mir156l-5p has been found to target beta-glucosidase genes and its expression was significantly upregulated at 4 °C [PMC6263057]. Furthermore, it has been observed that osa-mir156l-5p competes with TCONS_00049880 and OsMADS27 for binding sites [PMC7843763]. In terms of expression levels, osa-miR156a-j were highly expressed while osa-miR156k was lowly expressed [PMC4570225]. Overall, these findings highlight the importance of osa-mir156l-5p in plant development and stress responses.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CGACAGAAGAGAGUGAGCAUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Cynara cardunculus var. scolymus cca-miR156e
  2. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR156l-5p
Publications