Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-329-5p URS00001DC9B8_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-329: Mmu-mir-329 is a miRNA that has diverged between human and mouse. In humans, there are two identical copies of a distantly-related miRNA, HP-33 and HP-34, at the syntenic location of mmu-mir-329. In contrast, the mouse cluster containing mmu-mir-329 also includes other related sequences such as mmu-mir-323, MP-35, MN-7, and MP-37. However, the mouse cluster has an additional rodent-specific sequence called MN-7 that is not related to the other sequences in the cluster [PMC1315341]. Taqman primers were used to detect various miRNAs including mmu-mir-329 [PMC9510147]. Mmu-mir-329 was found to be upregulated in primary cortical neurons and in the prefrontal cortex of depression mouse models induced by insulin resistance or chronic unpredictable mild stress. Its levels were reduced upon eucalyptol treatment both in vitro and in vivo [PMC8715124]. Mmu-mir-329 was also identified as a candidate miRNA using the TargetScan database [PMC8715124]. Mmu-mir-329 has been implicated in basal cell carcinoma by targeting Axin1 and Dvl2 [PMC3573770]. The Cytoscape program was used to visualize the regulation of mRNA targets by mmu-miR669c, mmu-mir-329 (upregulated), and mmu-miR688, mmu-miR30c1*, mmu-miR201, mmu-miR761, and mmu-miR715 (downregulated) in Tff2-KO mice [PMC3573770].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGAGGUUUUCUGGGUCUCUGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Publications