Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-5091 URS00001D99D1_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-miR-5091: Hsa-mir-5091 is a microRNA that has been identified in various studies as a potential biomarker for different types of cancer, including colorectal cancer (CRC), pancreatic ductal adenocarcinoma, and glioma [PMC6863365] [PMC7362410] [PMC7393356]. However, the specific role and mechanism of hsa-mir-5091 in tumors, particularly in CRC, have not been fully elucidated and require further investigation [PMC6863365]. In CRC prognostic prediction models, hsa-mir-5091 has been included as one of the molecules used for risk score calculation and survival prediction [PMC8176021]. Additionally, hsa-mir-5091 has been found to have overlapping target genes with other miRNAs in different cancer types [PMC6863365]. In the context of a prognostic signature for CRC, hsa-mir-5091 is one of the miRNAs used to construct the risk score formula [PMC6089101]. Overall, hsa-mir-5091 shows potential as a biomarker for cancer prognosis and risk prediction. However, further research is needed to fully understand its functional role and mechanism in different types of tumors.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACGGAGACGACAAGACUGUGCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications