Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C Glutamate tRNA (tRNA-Glu), predicted by tRNAscan-SE analysis secondary structure diagram

Saccharomyces cerevisiae S288C Glutamate tRNA (tRNA-Glu), predicted by tRNAscan-SE analysis URS00001D6320_559292

Automated summary: This tRNA sequence is 72 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 4 databases (SGD, GtRNAdb, Rfam, ENA). Described in 32 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (tRNA, RF00005). Saccharomyces cerevisiae S288C Glutamate tRNA (tRNA-Glu), predicted by tRNAscan-SE analysis sequence is a product of tRNA-Glu-CTC-1-2, tRNA-Glu-CTC-1-1 genes. Found in the Saccharomyces cerevisiae S288C reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UCCGAUGUAGUGUAACGGCUAUCACAUCACGUUCUCACCGUGGAGACCGGGGUUCGACUCCCCGCUUCGGAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 129 other species

    1. Saccharomyces arboricola H-6 tRNA-Glu (CTC) (tRNA-Glu-CTC-1-1, tRNA-Glu-CTC-1-2)
    2. Saccharomyces boulardii (nom. inval.) tRNA-Glu (CTC) (tRNA-Glu-CTC-1-1, tRNA-Glu-CTC-1-2)
    3. Saccharomyces cerevisiae AWRI796 tRNA-Glu (CTC) (tRNA-Glu-CTC-1-1, tRNA-Glu-CTC-1-2)
    4. Saccharomyces cerevisiae (baker's yeast) tRNA-glu, anticodon ctc
    5. Saccharomyces cerevisiae CBS 7960 tRNA-Glu (CTC) (tRNA-Glu-CTC-1-1, tRNA-Glu-CTC-1-2)
    6. Saccharomyces cerevisiae CEN.PK113-7D tRNA-Glu (CTC) (tRNA-Glu-CTC-1-1, tRNA-Glu-CTC-1-2)
    7. Saccharomyces cerevisiae CLIB215 tRNA-Glu (CTC) (tRNA-Glu-CTC-1-1, tRNA-Glu-CTC-1-2)
    8. Saccharomyces cerevisiae CLIB324 tRNA-Glu (CTC) (tRNA-Glu-CTC-1-1)
    9. Saccharomyces cerevisiae CLIB382 tRNA-Glu (CTC) (tRNA-Glu-CTC-1-1)
    10. Saccharomyces cerevisiae EC1118 tRNA-Glu (CTC) (tRNA-Glu-CTC-1-1, tRNA-Glu-CTC-1-2)
    11. Saccharomyces cerevisiae EC9-8 tRNA-Glu (CTC) (tRNA-Glu-CTC-1-1, tRNA-Glu-CTC-1-2)
    12. Saccharomyces cerevisiae FL100 tRNA-Glu (CTC) (tRNA-Glu-CTC-1-1, tRNA-Glu-CTC-1-2)
    13. Saccharomyces cerevisiae FostersB tRNA-Glu (CTC) (tRNA-Glu-CTC-1-1, tRNA-Glu-CTC-1-2)
    14. Saccharomyces cerevisiae FostersO tRNA
    15. Saccharomyces cerevisiae Kyokai no. 7 tRNA-Glu (CTC) (tRNA-Glu-CTC-1-1, tRNA-Glu-CTC-1-2)
    16. Saccharomyces cerevisiae Lalvin QA23 tRNA-Glu (CTC) (tRNA-Glu-CTC-1-1, tRNA-Glu-CTC-1-2)
    17. Saccharomyces cerevisiae P283 tRNA-Glu (CTC) (tRNA-Glu-CTC-1-1, tRNA-Glu-CTC-1-2)
    18. Saccharomyces cerevisiae P301 tRNA-Glu (CTC) (tRNA-Glu-CTC-1-1)
    19. Saccharomyces cerevisiae PE-2 tRNA-Glu
    20. Saccharomyces cerevisiae PW5 tRNA-Glu (CTC) (tRNA-Glu-CTC-1-1, tRNA-Glu-CTC-1-2)
    21. Saccharomyces cerevisiae R008 tRNA-Glu (CTC) (tRNA-Glu-CTC-1-1, tRNA-Glu-CTC-1-2)
    22. Saccharomyces cerevisiae R103 tRNA-Glu (CTC) (tRNA-Glu-CTC-1-1, tRNA-Glu-CTC-1-2)
    23. Saccharomyces cerevisiae RM11-1a tRNA-Glu (CTC) (tRNA-Glu-CTC-1-1, tRNA-Glu-CTC-1-2)
    24. Saccharomyces cerevisiae Sigma1278b tRNA-Glu (CTC) (tRNA-Glu-CTC-1-1, tRNA-Glu-CTC-1-2)
    25. Saccharomyces cerevisiae T7 tRNA-Glu (CTC) (tRNA-Glu-CTC-1-1, tRNA-Glu-CTC-1-2)
    26. Saccharomyces cerevisiae UC5 tRNA-Glu (CTC) (tRNA-Glu-CTC-1-1, tRNA-Glu-CTC-1-2)
    27. Saccharomyces cerevisiae UFMG A-905 tRNA-Glu (CTC) (tRNA-Glu-CTC-1-1, tRNA-Glu-CTC-1-2)
    28. Saccharomyces cerevisiae Vin13 tRNA-Glu (CTC) (tRNA-Glu-CTC-1-1, tRNA-Glu-CTC-1-2)
    29. Saccharomyces cerevisiae VL3 tRNA-Glu (CTC) (tRNA-Glu-CTC-1-1, tRNA-Glu-CTC-1-2)
    30. Saccharomyces cerevisiae W303 tRNA-Glu (CTC) (tRNA-Glu-CTC-1-1, tRNA-Glu-CTC-1-2)
    31. Saccharomyces cerevisiae Y10 tRNA-Glu (CTC) (tRNA-Glu-CTC-1-1, tRNA-Glu-CTC-1-2)
    32. Saccharomyces cerevisiae YJM1078 tRNA-Glu
    33. Saccharomyces cerevisiae YJM1083 tRNA-Glu
    34. Saccharomyces cerevisiae YJM1129 tRNA-Glu
    35. Saccharomyces cerevisiae YJM1133 tRNA-Glu
    36. Saccharomyces cerevisiae YJM1190 tRNA-Glu
    37. Saccharomyces cerevisiae YJM1199 tRNA-Glu
    38. Saccharomyces cerevisiae YJM1202 tRNA-Glu
    39. Saccharomyces cerevisiae YJM1208 tRNA-Glu
    40. Saccharomyces cerevisiae YJM1242 tRNA-Glu
    41. Saccharomyces cerevisiae YJM1244 tRNA-Glu
    42. Saccharomyces cerevisiae YJM1248 tRNA-Glu
    43. Saccharomyces cerevisiae YJM1250 tRNA-Glu
    44. Saccharomyces cerevisiae YJM1252 tRNA-Glu
    45. Saccharomyces cerevisiae YJM1273 tRNA-Glu
    46. Saccharomyces cerevisiae YJM1304 tRNA-Glu
    47. Saccharomyces cerevisiae YJM1307 tRNA-Glu
    48. Saccharomyces cerevisiae YJM1311 tRNA-Glu
    49. Saccharomyces cerevisiae YJM1326 tRNA-Glu
    50. Saccharomyces cerevisiae YJM1332 tRNA-Glu
    51. Saccharomyces cerevisiae YJM1336 tRNA-Glu
    52. Saccharomyces cerevisiae YJM1338 tRNA-Glu
    53. Saccharomyces cerevisiae YJM1341 tRNA-Glu
    54. Saccharomyces cerevisiae YJM1342 tRNA-Glu
    55. Saccharomyces cerevisiae YJM1355 tRNA-Glu
    56. Saccharomyces cerevisiae YJM1356 tRNA-Glu
    57. Saccharomyces cerevisiae YJM1381 tRNA-Glu
    58. Saccharomyces cerevisiae YJM1383 tRNA-Glu
    59. Saccharomyces cerevisiae YJM1385 tRNA-Glu
    60. Saccharomyces cerevisiae YJM1386 tRNA-Glu
    61. Saccharomyces cerevisiae YJM1387 tRNA-Glu
    62. Saccharomyces cerevisiae YJM1388 tRNA-Glu
    63. Saccharomyces cerevisiae YJM1389 tRNA-Glu
    64. Saccharomyces cerevisiae YJM1399 tRNA-Glu
    65. Saccharomyces cerevisiae YJM1400 tRNA-Glu
    66. Saccharomyces cerevisiae YJM1401 tRNA-Glu
    67. Saccharomyces cerevisiae YJM1402 tRNA-Glu
    68. Saccharomyces cerevisiae YJM1415 tRNA-Glu
    69. Saccharomyces cerevisiae YJM1417 tRNA-Glu
    70. Saccharomyces cerevisiae YJM1418 tRNA-Glu
    71. Saccharomyces cerevisiae YJM1419 tRNA-Glu
    72. Saccharomyces cerevisiae YJM1433 tRNA-Glu
    73. Saccharomyces cerevisiae YJM1434 tRNA-Glu
    74. Saccharomyces cerevisiae YJM1439 tRNA-Glu
    75. Saccharomyces cerevisiae YJM1443 tRNA-Glu
    76. Saccharomyces cerevisiae YJM1444 tRNA-Glu
    77. Saccharomyces cerevisiae YJM1447 tRNA-Glu
    78. Saccharomyces cerevisiae YJM1450 tRNA-Glu
    79. Saccharomyces cerevisiae YJM1460 tRNA-Glu
    80. Saccharomyces cerevisiae YJM1463 tRNA-Glu
    81. Saccharomyces cerevisiae YJM1477 tRNA-Glu
    82. Saccharomyces cerevisiae YJM1478 tRNA-Glu
    83. Saccharomyces cerevisiae YJM1479 tRNA-Glu
    84. Saccharomyces cerevisiae YJM1526 tRNA-Glu
    85. Saccharomyces cerevisiae YJM1527 tRNA-Glu
    86. Saccharomyces cerevisiae YJM1549 tRNA-Glu
    87. Saccharomyces cerevisiae YJM1573 tRNA-Glu
    88. Saccharomyces cerevisiae YJM1574 tRNA-Glu
    89. Saccharomyces cerevisiae YJM1592 tRNA-Glu
    90. Saccharomyces cerevisiae YJM1615 tRNA-Glu
    91. Saccharomyces cerevisiae YJM189 tRNA-Glu
    92. Saccharomyces cerevisiae YJM193 tRNA-Glu
    93. Saccharomyces cerevisiae YJM195 tRNA-Glu
    94. Saccharomyces cerevisiae YJM244 tRNA-Glu
    95. Saccharomyces cerevisiae YJM248 tRNA-Glu
    96. Saccharomyces cerevisiae YJM269 tRNA-Glu (CTC) (tRNA-Glu-CTC-1-1, tRNA-Glu-CTC-1-2)
    97. Saccharomyces cerevisiae YJM270 tRNA-Glu
    98. Saccharomyces cerevisiae YJM271 tRNA-Glu
    99. Saccharomyces cerevisiae YJM320 tRNA-Glu
    100. Saccharomyces cerevisiae YJM326 tRNA-Glu
    101. Saccharomyces cerevisiae YJM428 tRNA-Glu
    102. Saccharomyces cerevisiae YJM450 tRNA-Glu
    103. Saccharomyces cerevisiae YJM451 tRNA-Glu
    104. Saccharomyces cerevisiae YJM453 tRNA-Glu
    105. Saccharomyces cerevisiae YJM456 tRNA-Glu
    106. Saccharomyces cerevisiae YJM470 tRNA-Glu
    107. Saccharomyces cerevisiae YJM541 tRNA-Glu
    108. Saccharomyces cerevisiae YJM554 tRNA-Glu
    109. Saccharomyces cerevisiae YJM555 tRNA-Glu
    110. Saccharomyces cerevisiae YJM627 tRNA-Glu
    111. Saccharomyces cerevisiae YJM681 tRNA-Glu
    112. Saccharomyces cerevisiae YJM682 tRNA-Glu
    113. Saccharomyces cerevisiae YJM683 tRNA-Glu
    114. Saccharomyces cerevisiae YJM689 tRNA-Glu
    115. Saccharomyces cerevisiae YJM693 tRNA-Glu
    116. Saccharomyces cerevisiae YJM969 tRNA-Glu
    117. Saccharomyces cerevisiae YJM972 tRNA-Glu
    118. Saccharomyces cerevisiae YJM975 tRNA-Glu
    119. Saccharomyces cerevisiae YJM978 tRNA-Glu
    120. Saccharomyces cerevisiae YJM981 tRNA-Glu
    121. Saccharomyces cerevisiae YJM984 tRNA-Glu
    122. Saccharomyces cerevisiae YJM987 tRNA-Glu
    123. Saccharomyces cerevisiae YJM990 tRNA-Glu
    124. Saccharomyces cerevisiae YJM993 tRNA-Glu
    125. Saccharomyces cerevisiae YJM996 tRNA-Glu
    126. Saccharomyces cerevisiae YJSH1 tRNA-Glu (CTC) (tRNA-Glu-CTC-1-1, tRNA-Glu-CTC-1-2)
    127. Saccharomyces kudriavzevii IFO 1802 tRNA-Glu (CTC) (tRNA-Glu-CTC-1-1, tRNA-Glu-CTC-1-2)
    128. Saccharomyces pastorianus tRNA-Glu
    2D structure New