Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Pyrococcus woesei tRNA-Phe secondary structure diagram

Pyrococcus woesei tRNA-Phe URS00001D39A7_2262

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGGCGGUAGCUCAGCCUGGGAGAGCACCGGACUGAAGAUCCGGGUGUCGGGGGUUCAAAUCCCCCCCGCCCCACCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Methanocaldococcus jannaschii E-tRNA from Methanocaldococcus jannaschii (PDB 4V4N, chain B1)
  2. Pyrococcus abyssi GE5 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1)
  3. Pyrococcus furiosus COM1 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1)
  4. Pyrococcus furiosus DSM 3638 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1)
  5. Pyrococcus horikoshii OT3 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1)
  6. Pyrococcus horikoshii tRNA-Phe
  7. Pyrococcus kukulkanii tRNA-Phe
  8. Pyrococcus sp. NA2 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1)
  9. Pyrococcus sp. ST04 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1)
  10. Pyrococcus yayanosii CH1 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1)
  11. Thermococci archaeon tRNA-Phe
  12. Thermococcus chitonophagus tRNA-Phe
  13. uncultured Pyrococcus sp. tRNA
Relationships

Molecular Relationships

2D structure

Loading 2D structure...