Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C Small Cytoplasmic RNA secondary structure diagram

Saccharomyces cerevisiae S288C Small Cytoplasmic RNA URS00001CAAE9_559292

  • 522 nucleotides
  • 4 databases (ENA, IntAct, RefSeq, SGD)
  • Found in 29 species
  • SRP RNA

Automated summary: This SRP RNA sequence is 522 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 4 databases (RefSeq, SGD, ENA, IntAct). Described in 50 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (Fungi_SRP, RF01502). Saccharomyces cerevisiae S288C Small Cytoplasmic RNA sequence is a product of SCR1 gene. Found in the Saccharomyces cerevisiae S288C reference genome.

Interactions 11

According to IntAct, Saccharomyces cerevisiae S288C Small Cytoplasmic RNA interacts with:

Interaction id Participant Synonyms
EBI-11175301 P20424 D6W489 EBI-17997 P20424 P9513.14 SRH1 SRP54 Signal recognition particle 54 kDa protein homolog YPR088C srp54_yeast
EBI-11175120 P20424 D6W489 EBI-17997 P20424 P9513.14 SRH1 SRP54 Signal recognition particle 54 kDa protein homolog YPR088C srp54_yeast
EBI-11301414 P20424 D6W489 EBI-17997 P20424 P9513.14 SRH1 SRP54 Signal recognition particle 54 kDa protein homolog YPR088C srp54_yeast
EBI-11301108 P38688 D6W3G0 EBI-18011 P38688 SRP72 Signal recognition particle 72 kDa protein homolog YPL210C srp72_yeast
EBI-11301122 P38688 D6W3G0 EBI-18011 P38688 SRP72 Signal recognition particle 72 kDa protein homolog YPL210C srp72_yeast
EBI-11291449 P38688 D6W3G0 EBI-18011 P38688 SRP72 Signal recognition particle 72 kDa protein homolog YPL210C srp72_yeast
EBI-11297417 P38688 D6W3G0 EBI-18011 P38688 SRP72 Signal recognition particle 72 kDa protein homolog YPL210C srp72_yeast
EBI-11620784 P53632 D6W1V2 DNA polymerase kappa DNA polymerase sigma EBI-19517 HRC584 O0716 P53632 PAP2 TRF4 Topoisomerase 1-related protein TRF4 YOL115W pap2_yeast
EBI-11620790 Q08162 Chromosome disjunction protein 3 D6W244 DIS3 EBI-1740 O2197 Q08162 RRP44 Ribosomal RNA-processing protein 44 YOL021C rrp44_yeast
EBI-11621289 Q08162 Chromosome disjunction protein 3 D6W244 DIS3 EBI-1740 O2197 Q08162 RRP44 Ribosomal RNA-processing protein 44 YOL021C rrp44_yeast
EBI-11620796 Q12149 D6W267 EBI-1782 Q12149 Q6B280 RRP6 Ribosomal RNA-processing protein 6 UNC733 YOR001W rrp6_yeast

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AGGCUGUAAUGGCUUUCUGGUGGGAUGGGAUACGUUGAGAAUUCUGGCCGAGGAACAAAUCCUUCCUCGCGGCUAGACACGGAUUGCACGCCCUUUGGGCAAGGGAUAGUUCUCUAUUCCGCACCGUGCCCUGUUGUGGCAACCGUCUUUCCUCCGUCGUAAAUUUGUCCUGGGCAGAGCUGUCUGCCCGGAGGCGGGAGAGUCCGUUCUGAAGUGUCCCGGCUAUAAUAAAUCGAUCUUUGCGGGCAGCCCGUUGGCAGGAGGCGUGAGGAAUCCGUCUCUCUGUCUGGUGCGGCAAGGUAGUUCUGGGUCCUUAGGGGCUCCACCUUCACCGCUGUUAGGGGAGUUUUAUCCAGCGUCAGCAAAGGUGACCCGUGAUGGAGGCGGCCGGGAUAGCACAUAUCAGUCGGAUAAUUGUGCAAGUUGAUCGCUUCGGCGGUUUAAUUUGGCGGUGCCAUCAGGAUUUACUCGCACAUUGUGGCCGUUCCCUCGGGGAUGGAGUGUGUCCUGAACCAUAUUUUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 28 other species

    1. Saccharomyces cerevisiae (baker's yeast) SCR1
    2. Saccharomyces cerevisiae Kyokai no. 7 K7_SCR1
    3. Saccharomyces cerevisiae PE-2 SCR1
    4. Saccharomyces cerevisiae YJM1199 SCR1
    5. Saccharomyces cerevisiae YJM1202 SCR1
    6. Saccharomyces cerevisiae YJM1208 SCR1
    7. Saccharomyces cerevisiae YJM1250 SCR1
    8. Saccharomyces cerevisiae YJM1273 SCR1
    9. Saccharomyces cerevisiae YJM1338 SCR1
    10. Saccharomyces cerevisiae YJM1388 SCR1
    11. Saccharomyces cerevisiae YJM1389 SCR1
    12. Saccharomyces cerevisiae YJM1419 SCR1
    13. Saccharomyces cerevisiae YJM1434 SCR1
    14. Saccharomyces cerevisiae YJM1443 SCR1
    15. Saccharomyces cerevisiae YJM1444 SCR1
    16. Saccharomyces cerevisiae YJM1450 SCR1
    17. Saccharomyces cerevisiae YJM1460 SCR1
    18. Saccharomyces cerevisiae YJM1592 SCR1
    19. Saccharomyces cerevisiae YJM1615 SCR1
    20. Saccharomyces cerevisiae YJM271 SCR1
    21. Saccharomyces cerevisiae YJM320 SCR1
    22. Saccharomyces cerevisiae YJM428 SCR1
    23. Saccharomyces cerevisiae YJM451 SCR1
    24. Saccharomyces cerevisiae YJM456 SCR1
    25. Saccharomyces cerevisiae YJM470 SCR1
    26. Saccharomyces cerevisiae YJM541 SCR1
    27. Saccharomyces cerevisiae YJM555 SCR1
    28. Saccharomyces cerevisiae YJM693 SCR1
    2D structure New