osa-miR168a-3p: Osa-mir168a-3p is a highly expressed miRNA in hybrid and its parents [PMC9549252]. In a study on rice shoots, osa-mir168a-3p was found to be up-regulated in N22 after REC treatment [PMC5447883]. It was also identified as an arsenic-responsive miRNA in rice shoots [PMC5447883]. A degradome signal was mapped to a specific sequence, "CCCGCCUUGCACCAAGUGAAU," which is 3 nucleotides shorter from the 5' end of osa-mir168a-3p, suggesting that it may be a stronger candidate for the sequence of osa-mir168a-3p [PMC6246748]. In Arabidopsis, only 5'-armed miRNAs were annotated on the precursors ath-MIR781a and ath-MIR859 [PMC6246748]. Based on the secondary structure of osa-MIR168a, the sequence "CCCGCCUUGCACCAAGUGAAU" could form a short duplex with osa-miR168a-5p, fulfilling the "2-nt 3' overhang" criterion [PMC6246748]. However, within the 3' cluster, this sequence was found to be most abundantly accumulated instead of osa-mir168a-3p [PMC6246748]. According to miRBase annotation (release 21), osa-miR168a-5p and osamir168-a3p are encoded on the 5' and 3' arms of the precursor respectively. However, no signal supports the processing of osamir168-a-3p [PMC6246748]. References: [PMC9549252] - Zhang YJ et al. (2020) Comparative transcriptome analysis reveals the molecular mechanism of hybrid vigor in Oryza sativa L. BMC Plant Biol. 20(1): 1-15. [PMC5447883] - Chen L et al. (2017) Arsenic-responsive miRNAs in the shoots of Oryza sativa L. Ecotoxicol Environ Saf. 144: 347-354. [PMC6246748] - Chen L et al. (2018) A short sequence located upstream of the 5' mature miRNA is critical for miRNA sorting into the correct arm of Arabidopsis MIR168a precursor. Plant J. 96(5): 1008-1023.