Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Saccharomyces cerevisiae S288C RNA of Unknown Function URS00001C9907_559292

Genome locations

Gene Ontology annotations

Localisation

No annotated location

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCUAGGCAGAACGCCUAGUUUACACAGUGGGAGAAUGAGGAUAGGCCUCUGCCUACGGUACCUUCGAAUACAGGGAAAGUGGGAAGAGUGAGCUGCCGAAGUGAAAGAGGCUUACGCAUUUUUUCUUUGGGAAGCGGACGCAGGACUAAGCUCAUCAUUUUCGAAAAAAAAAGAAAGUUGGAGCCGGAAAGGAAUUGGGUGUUAAAAAUGUACGGGUGAAAAAAGUCUUAUUUUGUCUUAAAAGGGGUUCCCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

  1. Saccharomyces cerevisiae (baker's yeast) RUF23
  2. Saccharomyces cerevisiae PE-2 RUF23
  3. Saccharomyces cerevisiae YJM1129 RUF23
  4. Saccharomyces cerevisiae YJM1133 RUF23
  5. Saccharomyces cerevisiae YJM1202 RUF23
  6. Saccharomyces cerevisiae YJM1242 RUF23
  7. Saccharomyces cerevisiae YJM1244 RUF23
  8. Saccharomyces cerevisiae YJM1336 RUF23
  9. Saccharomyces cerevisiae YJM1355 RUF23
  10. Saccharomyces cerevisiae YJM1356 RUF23
  11. Saccharomyces cerevisiae YJM1383 RUF23
  12. Saccharomyces cerevisiae YJM1385 RUF23
  13. Saccharomyces cerevisiae YJM1415 RUF23
  14. Saccharomyces cerevisiae YJM1417 RUF23
  15. Saccharomyces cerevisiae YJM1477 RUF23
  16. Saccharomyces cerevisiae YJM193 RUF23
  17. Saccharomyces cerevisiae YJM244 RUF23
  18. Saccharomyces cerevisiae YJM271 RUF23
  19. Saccharomyces cerevisiae YJM320 RUF23
  20. Saccharomyces cerevisiae YJM541 RUF23
  21. Saccharomyces cerevisiae YJM681 RUF23
Publications