Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-661 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-661 precursor URS00001C4680_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-661: Hsa-mir-661 is a microRNA that has been identified as a candidate for promoting breast cancer development [PMC5308650]. However, it has also been found to be involved in blood mononuclear cells and the cortex of Alzheimer's patients [PMC7748118]. In Alzheimer's patients, the expression level of hsa-mir-661 is downregulated compared to healthy controls [PMC7748118]. Hsa-mir-661 has also been identified as a potential target for circRNAs in melanoma and colorectal cancer [PMC9740358] [PMC4516543]. Interestingly, hsa-mir-661, along with hsa-miR-494-3p, has been studied to predict potential target genes and signaling pathways in order to gain a better understanding of their roles in disease progression [PMC7748118]. Ontology analysis of hsa-mir-661 has revealed enrichment in various cellular processes such as the mitotic cell cycle, apoptotic signaling pathway, viral process, and cell death pathway [PMC8778063]. These findings suggest that hsa-mir-661 may play important roles in cancer development and progression.

MIR661: MIR661, a type of microRNA, has been investigated for its impact on cellular metabolism [PMC5709620]. A study found that the basal extracellular acidification rate (ECAR) of MIR661 cells was significantly affected compared to control cells, indicating disruption in glucose and glycolytic intermediates within the cells [PMC5709620]. Metabolomic analysis conducted in the study supported this observation [PMC5709620]. The researchers specifically focused on the DLD1 non-metastatic cell line, which exhibited lower levels of MIR661 expression compared to primary colon cell lines (Ccd18-Co and CCD841) [PMC5709620]. This selection aimed to explore the potential role of MIR661 in non-metastatic cells and its impact on cellular metabolism [PMC5709620].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGAGAGGCUGUGCUGUGGGGCAGGCGCAGGCCUGAGCCCUGGUUUCGGGCUGCCUGGGUCUCUGGCCUGCGCGUGACUUUGGGGUGGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications