Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-296-5p URS00001C3AC1_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-296: Rno-mir-296 is a microRNA that has been studied in various contexts. In a study comparing qPCR and deep-sequencing results, it was found that the expression patterns of most miRNAs were consistent, except for four miRNAs including rno-mir-296, which showed minor discrepancies [PMC3441217]. Rno-mir-296 was found to be down-regulated and predicted to target E2f1, which was significantly up-regulated after treatment with furan [PMC2974699]. In another study, rno-mir-296 was one of the four miRNAs that were significantly upregulated in stress-induced models [PMC3961114]. Additionally, rno-mir-296 showed the greatest change in expression with an approximately 8-fold down-regulation [PMC2974699]. The study also identified other differentially expressed miRNAs in stress-induced models, including rno-miR-141, rno-miR-382, and rno-miR-219-5p (upregulated) and miR-135a and miR-466b (downregulated) [PMC3961114]. These findings suggest that rno-mir-296 may be involved in stress-induced myocardial injury at the molecular level. Overall, rno-mir-296 has been shown to exhibit altered expression patterns in different contexts and may play a role in various biological processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGGCCCCCCCUCAAUCCUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

  1. Callithrix jacchus cja-miR-296
  2. Cavia porcellus cpo-miR-296-5p
  3. Homo sapiens hsa-miR-296-5p
  4. Macaca mulatta (Rhesus monkey) mml-miR-296-5p
  5. Mus musculus mmu-miR-296-5p
  6. Pongo pygmaeus (Bornean orangutan) ppy-miR-296-5p
Publications