Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae YJM1383 SRG1 secondary structure diagram

Saccharomyces cerevisiae YJM1383 SRG1 URS00001C0676_1294356

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAAUGCCUUUGUUUGGCCAAGCUAUGUGCAAAUAUCACAAAUUAAAAAUUUGGUUAAGCAGUUAGGCUGGACCUAAUAUUUUAGAAAAACCUAAUUUUUUUUGUGGACCCAUUUUCGAUAUUUACUCACAAAUGGAAUUCAAGGGGAACAACUUCGGUCUCAGCACUUUAAUUAUUCUUCUCGUUCCCACCUAAUUUCGCAAUUUAUUGUCCUUGACUUCUACCACGAGAAAAAAAUUAAGAAAAUGCAACGCUGCCCGUGCAGGGUUUUCUGAGCGGGAUGAAAAAAUCAGACAAAUAUCCAAGUUAUGAGUAAUUACUUUGUUGGAAGGAGGGAGCAGAGGAUAAGGAAAUUCUUAAAACUGUUAUGUAUAUAAAGGAAGAACCAUUUCUAGUUAUUUCACUUUUUGAUACUUGUCAACUAUCUUAGUAAAAAUACAGAACUCUAUAAAGAACCACAGAAAAAUCGACAGCAAUGACAAGCAUUGACAUUAACAACUUACAAAAUACCUUUCAACAAGCUAUGAAUAUGAGCGGCUCCCCAGGCGCUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

  1. Saccharomyces cerevisiae (baker's yeast) SRG1
  2. Saccharomyces cerevisiae S288C SER3 Regulatory Gene
  3. Saccharomyces cerevisiae YJM1244 SRG1
  4. Saccharomyces cerevisiae YJM1356 SRG1
  5. Saccharomyces cerevisiae YJM693 SRG1
2D structure