v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Escherichia sp. TM-G17TGC tRNA-Met secondary structure diagram

Escherichia sp. TM-G17TGC tRNA-Met URS00001BBAFC_2860337

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CGCGGGGUGGAGCAGCCUGGUAGCUCGUCGGGCUCAUAACCCGAAGAUCGUCGGUUCAAAUCCGGCCCCCGCAACCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 42 other species

  1. Acinetobacter pittii tRNA-Met
  2. Escherichia coli 3-373-03_S4_C1 tRNA-Met
  3. Escherichia coli 3-373-03_S4_C2 tRNA-Met
  4. Escherichia coli 3-373-03_S4_C3 tRNA-Met
  5. Escherichia coli Bal225 tRNA-Met
  6. Escherichia coli BW25113 tRNA-fMet (CAT) (tRNA-fMet-CAT-2-1)
  7. Escherichia coli BW2952 tRNA-fMet (CAT) (tRNA-fMet-CAT-2-1)
  8. Escherichia coli DH1 tRNA-fMet (CAT) (tRNA-fMet-CAT-2-1)
  9. Escherichia coli ER2796 tRNA-fMet (CAT) (tRNA-fMet-CAT-2-1)
  10. Escherichia coli HT115 tRNA-Met
  11. Escherichia coli J53 tRNA-Met
  12. Escherichia coli K-12 tRNA-fMet (CAT) (tRNA-fMet-CAT-2-1)
  13. Escherichia coli KLY tRNA-fMet (CAT) (tRNA-fMet-CAT-2-1)
  14. Escherichia coli NCTC 50110 tRNA-Met
  15. Escherichia coli O16:H48 tRNA-Met
  16. Escherichia coli S17 tRNA-Met
  17. Escherichia coli str. K-12 substr. DH10B tRNA-fMet (CAT) (tRNA-fMet-CAT-2-1)
  18. Escherichia coli str. K-12 substr. MC4100 tRNA-fMet (CAT) (tRNA-fMet-CAT-2-1)
  19. Escherichia coli str. K-12 substr. MDS42 tRNA-fMet (CAT) (tRNA-fMet-CAT-2-1)
  20. Escherichia coli str. K-12 substr. MG1655 tRNA-fMet (CAT) (tRNA-fMet-CAT-2-1)
  21. Escherichia coli str. K-12 substr. W3110 tRNA-fMet (CAT) (tRNA-fMet-CAT-2-1)
  22. Escherichia coli tRNA-fMet (CAT) (tRNA-fMet-CAT-2-1)
  23. Escherichia coli XH001 tRNA-Met
  24. Escherichia sp. Gen1 tRNA-Met
  25. Escherichia sp. TC-EC600-tetX4 tRNA-Met
  26. Acinetobacter baumannii ATCC 19606 = CIP 70.34 = JCM 6841 E-site tRNA from Acinetobacter baumannii ATCC 19606 = CIP 70.34 = JCM 6841 (PDB 6YTF, chain 7)
  27. synthetic construct FORMYL-METHIONYL-TRNAFMET2 from synthetic construct (PDB 2FMT, chain D)
  28. Klebsiella pneumoniae tRNA-Met(cat)
  29. Thermus thermophilus HB27 P-site tRNAfMET from Thermus thermophilus HB27 (PDB 4V4J, chain z)
  30. Thermus thermophilus P-tRNA from Thermus thermophilus (PDB 3J9Z, chain S6)
  31. Salmonella enterica subsp. enterica serovar Anatum tRNA-Met
  32. Salmonella enterica subsp. enterica serovar Copenhagen tRNA-Met
  33. Salmonella enterica subsp. enterica serovar Newport tRNA-Met
  34. Salmonella enterica subsp. enterica serovar Typhimurium (Salmonella typhimurium) tRNA-Met
  35. Salmonella enterica subsp. enterica tRNA-Met
  36. Salmonella enterica tRNA-Met
  37. Salmonella sp. HNK130 tRNA-Met
  38. Shigella flexneri tRNA-Met
  39. Shigella sp. tRNA-Met
  40. synthetic Escherichia coli C321.deltaA tRNA-fMet (CAT) (tRNA-fMet-CAT-2-1)
  41. uncultured bacterium tRNA-Met
  42. Xanthomonas citri pv. citri tRNA-Met
 2D structure