Gallus gallus (chicken) gga-miR-216a URS00001B8460_9031

• 21 nucleotides
• 2 databases (miRBase, RefSeq)
• Found in 12 other species
• 52 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UAAUCUCAGCUGGCAACUGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

1. Alligator mississippiensis ami-miR-216a-5p
2. Canis lupus familiaris cfa-miR-216a
3. Gorilla gorilla gorilla ggo-miR-216 (MIR216)
4. Gorilla gorilla ggo-miR-216
5. Homo sapiens microRNA mir-216
6. Lemur catta lca-miR-216
7. Monodelphis domestica (gray short-tailed opossum) mdo-miR-216
8. Pan paniscus (pygmy chimpanzee) ppa-miR-216
9. Pan troglodytes (chimpanzee) microRNA mir-216
10. Pongo pygmaeus (Bornean orangutan) ppy-miR-216a
11. Sarcophilus harrisii sha-miR-216a
12. Xenopus tropicalis xtr-miR-216

Publications Download

• FASTA
• JSON