Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Arabidopsis lyrata (lyrate rockcress) aly-miR168b-5p URS00001B7B42_59689

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

aly-miR168a-5p: Aly-mir168a-5p is a miRNA that was selected as a target gene in a study [PMC8304282]. The study investigated the expression patterns of three miRNAs (aly-miR164c-5p, aly-mir168a-5p, and smo-miR396) under various stresses or in different tissues [PMC8304282]. The expression levels of smo-miR396 and aly-mir168a-5p were found to be downregulated under salt and ABA treatments when using unstable reference genes (RGs) [PMC8304282]. Similarly, under heat/drought/GA3 treatments, the expression levels of smo-miR396 and aly-mir168a-5p were often underestimated when using unstable RGs [PMC8304282]. The study used stable and unstable RGs to assess the expression of the target miRNAs and found that unstable RGs led to incorrect estimation or misestimation of miRNA expression levels or trends [PMC8304282]. Aly-miR164c-5p, aly-mir168a-5p, and smo-miR396 were highly expressed in stems or seeds, but their expression levels were often misestimated when using unstable RGs compared to stable RGs [PMC8304282]. Under cold treatment, the expression of aly-mir168a-5p was downregulated when using stable RGs but upregulated when using unstable internal control genes [PMC8304282]. Reference: [PMC8304282]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCGCUUGGUGCAGGUCGGGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 43 other species

  1. Aethionema grandiflorum microRNA miR168b
  2. Allium sativum partial miR168a-5p
  3. Amborella trichopoda atr-miR168
  4. Ananas comosus microRNA 168a
  5. Arabidopsis thaliana ath-miR168a-5p
  6. Asparagus officinalis (garden asparagus) aof-miR168a
  7. Brassica napus (rape) bna-miR168a
  8. Brassica rapa bra-miR168a-5p
  9. Calepina irregularis microRNA miR168b
  10. Capsella grandiflora microRNA miR168b
  11. Cardamine alpina microRNA miR168b
  12. Cardamine flexuosa (woodland bittercress) miR168a
  13. Cardamine hirsuta microRNA miR168b
  14. Cardamine impatiens microRNA miR168b
  15. Citrus reticulata (tangerine) crt-miR168
  16. Citrus sinensis (sweet orange) csi-miR168-5p
  17. Citrus x clementina (clementine) ccl-miR168
  18. Corchorus capsularis sRNA CCACVL1_07160
  19. Corchorus olitorius aly-miR168a-
  20. Cynara cardunculus (wild artichoke) cca-miR168a
  21. Erysimum cheiri microRNA miR168b
  22. Eutrema halophilum microRNA miR168b
  23. Fragaria vesca subsp. vesca fve-miR168-5p
  24. Glycine max gma-miR168a
  25. Helianthus annuus (common sunflower) ath-miR168a-5p
  26. Linum usitatissimum (flax) lus-miR168b
  27. Malcolmia maritima microRNA miR168b
  28. Malus domestica mdm-miR168a
  29. Manihot esculenta mes-miR168a
  30. Medicago truncatula mtr-miR168c-5p
  31. Nicotiana tabacum nta-miR168d
  32. Picea abies (Norway spruce) pab-miR168a
  33. Populus tomentosa Pto-miR168b-5p
  34. Populus trichocarpa (black cottonwood) ptc-miR168b-5p
  35. Prunus persica (peach) ppe-miR168
  36. Pseudoturritis turrita microRNA miR168b
  37. Ricinus communis (castor bean) rco-miR168
  38. Rorippa austriaca microRNA miR168b
  39. Rosa chinensis ath-miR168a-5p
  40. Theobroma cacao tcc-miR168
  41. Vigna unguiculata (cowpea) vun-miR168
  42. Vitis vinifera (wine grape) vvi-miR168
  43. Vriesea carinata vca-miR168b-5p
Publications