Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Marmota monax (woodchuck) tRNA.Leu secondary structure diagram

Marmota monax (woodchuck) tRNA.Leu URS00001B506A_9995

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUAGCGUGGCCGAGCGGUCUAAGGCGCUGGAUUUAGGCUCCAGUCUCUUCGGAGGCGUGGGUUCGAAUCCCACCGCUGCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 57 other species

  1. Ailuropoda melanoleuca tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
  2. Balaenoptera acutorostrata scammoni tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
  3. Bos taurus tRNA-Leu (TAG) (tRNA-Leu-TAG-2-1)
  4. Callithrix jacchus tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
  5. Camelus ferus (Wild Bactrian camel) tRNA
  6. Canis lupus familiaris tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
  7. Carlito syrichta tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
  8. Cavia porcellus tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
  9. Ceratotherium simum simum tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1, tRNA-Leu-TAG-1-2)
  10. Cervus elaphus hippelaphus tRNA-Leu
  11. Chlorocebus sabaeus tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
  12. Choloepus hoffmanni tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
  13. Dasypus novemcinctus tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
  14. Echinops telfairi tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
  15. Equus caballus tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
  16. Felis catus tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
  17. Fukomys damarensis tRNA
  18. Gorilla gorilla gorilla tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
  19. Heterocephalus glaber tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
  20. Homo sapiens tRNA-Leu (anticodon TAG) 1-1 (TRL-TAG1-1)
  21. Ictidomys tridecemlineatus tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
  22. Lepisosteus oculatus (spotted gar) tRNA
  23. Loxodonta africana tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
  24. Macaca mulatta tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
  25. Mesocricetus auratus (golden hamster) tRNA
  26. Microcebus murinus tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
  27. Monodelphis domestica tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
  28. Mus caroli tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
  29. Mus musculus castaneus tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
  30. Mus musculus domesticus tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
  31. Mus musculus musculus tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
  32. Mus musculus tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
  33. Mus pahari tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
  34. Mus spretus tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
  35. Mustela putorius furo tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
  36. Neotoma lepida (desert woodrat) tRNA
  37. Nomascus leucogenys tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
  38. Notamacropus eugenii tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1, tRNA-Leu-TAG-1-2)
  39. Ochotona princeps tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
  40. Oryctolagus cuniculus tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
  41. Otolemur garnettii tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
  42. Ovis aries tRNA-Leu (TAG) (tRNA-Leu-TAG-2-1)
  43. Pangasianodon gigas (Mekong giant catfish) tRNA-Leu
  44. Pangasianodon hypophthalmus tRNA-Leu
  45. Pan troglodytes tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
  46. Papio anubis tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
  47. Pongo abelii tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
  48. Procavia capensis tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
  49. Pteropus alecto tRNA
  50. Rattus norvegicus tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
  51. Saimiri boliviensis boliviensis tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
  52. Sarcophilus harrisii tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
  53. Sorex araneus tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
  54. Sus scrofa tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1, tRNA-Leu-TAG-1-2)
  55. Trichechus manatus latirostris tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
  56. Tursiops truncatus tRNA-Leu (TAG) (tRNA-Leu-TAG-2-1)
  57. Vicugna pacos tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1, tRNA-Leu-TAG-1-2)
2D structure