Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-520e-3p URS00001A5F54_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-520e: Hsa-mir-520e is a microRNA that has been identified as the target miRNA of SYDE1 and has shown favorable outcomes in gliomas [PMC8552071]. To assess the prognostic ability of hsa-mir-520e and its target lncRNAs (FGD5-AS1, MIR17HG, and SNHG16), their expression levels were measured [PMC8552071]. AKTIP is targeted by hsa-miR-520b and hsa-mir-520e, CDK6 is targeted by hsa-miR-320a and hsa-miR-449a, PAG1 is targeted by hsa-miR-429 and hsa-miR-1193, and RORA is targeted by hsa-miR-107 and hsa-miR-137 [PMC6595612]. In COLO 320 and COLO 205 cells, miRNAs such as hsa-mir-21, hsa-mir-20a, hsa-mir-92a-1, among others were upregulated and involved in cell cycle regulation, cell differentiation, migration, and invasion. Conversely, miRNAs such as has mir 539 were downregulated in both primary and metastatic colon cancer cells [PMC9941246]. The biological targets of differentially expressed miRNAs (DEMs) were predicted using four different software programs. However, the gene targets of specific miRNAs like has mir 455 were not predicted using the PicTar software [PMC7410007].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAAGUGCUUCCUUUUUGAGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Pan troglodytes (chimpanzee) ptr-miR-520e
  2. Pongo pygmaeus ppy-miR-520e
Publications