Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C Elongator MeThionine-accepting tRNA secondary structure diagram

Saccharomyces cerevisiae S288C Elongator MeThionine-accepting tRNA URS00001A5E2D_559292

Automated summary: This ncRNA sequence is 73 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 3 databases (SGD, ENA, Rfam). Described in 43 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (tRNA, RF00005). Saccharomyces cerevisiae S288C Elongator MeThionine-accepting tRNA sequence is a product of EMT4, tRNA-Met-CAT-1-2, EMT5, EMT3, tRNA-Met-CAT-1-5, tRNA-Met-CAT-1-3, tRNA-Met-CAT-1-1, tRNA-Met-CAT-1-4, EMT2, EMT1 genes. Found in the Saccharomyces cerevisiae S288C reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GCUUCAGUAGCUCAGUAGGAAGAGCGUCAGUCUCAUAAUCUGAAGGUCGAGAGUUCGAACCUCCCCUGGAGCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 115 other species

    1. Kazachstania africana CBS 2517 tRNA
    2. Naumovozyma dairenensis CBS 421 tRNA
    3. Pseudoalteromonas piscicida tRNA-Met
    4. Saccharomyces cerevisiae AWRI796 tRNA
    5. Saccharomyces cerevisiae (baker's yeast) Elongator tRNA-methionine
    6. Saccharomyces cerevisiae EC1118 tRNA-Met
    7. Saccharomyces cerevisiae FostersB tRNA
    8. Saccharomyces cerevisiae FostersO tRNA
    9. Saccharomyces cerevisiae Kyokai no. 7 tRNA-Met
    10. Saccharomyces cerevisiae Lalvin QA23 tRNA
    11. Saccharomyces cerevisiae P283 tRNA-Met
    12. Saccharomyces cerevisiae P301 tRNA-Met
    13. Saccharomyces cerevisiae PE-2 tRNA-Met
    14. Saccharomyces cerevisiae R008 tRNA-Met
    15. Saccharomyces cerevisiae R103 tRNA-Met
    16. Saccharomyces cerevisiae RM11-1a tRNA-Met
    17. Saccharomyces cerevisiae Vin13 tRNA
    18. Saccharomyces cerevisiae VL3 tRNA
    19. Saccharomyces cerevisiae YJM1078 tRNA-Met
    20. Saccharomyces cerevisiae YJM1083 tRNA-Met
    21. Saccharomyces cerevisiae YJM1129 tRNA-Met
    22. Saccharomyces cerevisiae YJM1133 tRNA-Met
    23. Saccharomyces cerevisiae YJM1190 tRNA-Met
    24. Saccharomyces cerevisiae YJM1199 tRNA-Met
    25. Saccharomyces cerevisiae YJM1202 tRNA-Met
    26. Saccharomyces cerevisiae YJM1208 tRNA-Met
    27. Saccharomyces cerevisiae YJM1242 tRNA-Met
    28. Saccharomyces cerevisiae YJM1244 tRNA-Met
    29. Saccharomyces cerevisiae YJM1248 tRNA-Met
    30. Saccharomyces cerevisiae YJM1250 tRNA-Met
    31. Saccharomyces cerevisiae YJM1252 tRNA-Met
    32. Saccharomyces cerevisiae YJM1273 tRNA-Met
    33. Saccharomyces cerevisiae YJM1304 tRNA-Met
    34. Saccharomyces cerevisiae YJM1307 tRNA-Met
    35. Saccharomyces cerevisiae YJM1311 tRNA-Met
    36. Saccharomyces cerevisiae YJM1326 tRNA-Met
    37. Saccharomyces cerevisiae YJM1332 tRNA-Met
    38. Saccharomyces cerevisiae YJM1336 tRNA-Met
    39. Saccharomyces cerevisiae YJM1338 tRNA-Met
    40. Saccharomyces cerevisiae YJM1341 tRNA-Met
    41. Saccharomyces cerevisiae YJM1342 tRNA-Met
    42. Saccharomyces cerevisiae YJM1355 tRNA-Met
    43. Saccharomyces cerevisiae YJM1356 tRNA-Met
    44. Saccharomyces cerevisiae YJM1381 tRNA-Met
    45. Saccharomyces cerevisiae YJM1383 tRNA-Met
    46. Saccharomyces cerevisiae YJM1385 tRNA-Met
    47. Saccharomyces cerevisiae YJM1386 tRNA-Met
    48. Saccharomyces cerevisiae YJM1387 tRNA-Met
    49. Saccharomyces cerevisiae YJM1388 tRNA-Met
    50. Saccharomyces cerevisiae YJM1389 tRNA-Met
    51. Saccharomyces cerevisiae YJM1399 tRNA-Met
    52. Saccharomyces cerevisiae YJM1400 tRNA-Met
    53. Saccharomyces cerevisiae YJM1401 tRNA-Met
    54. Saccharomyces cerevisiae YJM1402 tRNA-Met
    55. Saccharomyces cerevisiae YJM1415 tRNA-Met
    56. Saccharomyces cerevisiae YJM1417 tRNA-Met
    57. Saccharomyces cerevisiae YJM1418 tRNA-Met
    58. Saccharomyces cerevisiae YJM1419 tRNA-Met
    59. Saccharomyces cerevisiae YJM1433 tRNA-Met
    60. Saccharomyces cerevisiae YJM1434 tRNA-Met
    61. Saccharomyces cerevisiae YJM1439 tRNA-Met
    62. Saccharomyces cerevisiae YJM1443 tRNA-Met
    63. Saccharomyces cerevisiae YJM1444 tRNA-Met
    64. Saccharomyces cerevisiae YJM1447 tRNA-Met
    65. Saccharomyces cerevisiae YJM1450 tRNA-Met
    66. Saccharomyces cerevisiae YJM1460 tRNA-Met
    67. Saccharomyces cerevisiae YJM1463 tRNA-Met
    68. Saccharomyces cerevisiae YJM1477 tRNA-Met
    69. Saccharomyces cerevisiae YJM1478 tRNA-Met
    70. Saccharomyces cerevisiae YJM1479 tRNA-Met
    71. Saccharomyces cerevisiae YJM1526 tRNA-Met
    72. Saccharomyces cerevisiae YJM1527 tRNA-Met
    73. Saccharomyces cerevisiae YJM1549 tRNA-Met
    74. Saccharomyces cerevisiae YJM1573 tRNA-Met
    75. Saccharomyces cerevisiae YJM1574 tRNA-Met
    76. Saccharomyces cerevisiae YJM1592 tRNA-Met
    77. Saccharomyces cerevisiae YJM1615 tRNA-Met
    78. Saccharomyces cerevisiae YJM189 tRNA-Met
    79. Saccharomyces cerevisiae YJM193 tRNA-Met
    80. Saccharomyces cerevisiae YJM195 tRNA-Met
    81. Saccharomyces cerevisiae YJM244 tRNA-Met
    82. Saccharomyces cerevisiae YJM248 tRNA-Met
    83. Saccharomyces cerevisiae YJM270 tRNA-Met
    84. Saccharomyces cerevisiae YJM271 tRNA-Met
    85. Saccharomyces cerevisiae YJM320 tRNA-Met
    86. Saccharomyces cerevisiae YJM326 tRNA-Met
    87. Saccharomyces cerevisiae YJM428 tRNA-Met
    88. Saccharomyces cerevisiae YJM450 tRNA-Met
    89. Saccharomyces cerevisiae YJM451 tRNA-Met
    90. Saccharomyces cerevisiae YJM453 tRNA-Met
    91. Saccharomyces cerevisiae YJM456 tRNA-Met
    92. Saccharomyces cerevisiae YJM470 tRNA-Met
    93. Saccharomyces cerevisiae YJM541 tRNA-Met
    94. Saccharomyces cerevisiae YJM554 tRNA-Met
    95. Saccharomyces cerevisiae YJM555 tRNA-Met
    96. Saccharomyces cerevisiae YJM627 tRNA-Met
    97. Saccharomyces cerevisiae YJM681 tRNA-Met
    98. Saccharomyces cerevisiae YJM682 tRNA-Met
    99. Saccharomyces cerevisiae YJM683 tRNA-Met
    100. Saccharomyces cerevisiae YJM689 tRNA-Met
    101. Saccharomyces cerevisiae YJM693 tRNA-Met
    102. Saccharomyces cerevisiae YJM969 tRNA-Met
    103. Saccharomyces cerevisiae YJM972 tRNA-Met
    104. Saccharomyces cerevisiae YJM975 tRNA-Met
    105. Saccharomyces cerevisiae YJM978 tRNA-Met
    106. Saccharomyces cerevisiae YJM981 tRNA-Met
    107. Saccharomyces cerevisiae YJM984 tRNA-Met
    108. Saccharomyces cerevisiae YJM987 tRNA-Met
    109. Saccharomyces cerevisiae YJM990 tRNA-Met
    110. Saccharomyces cerevisiae YJM993 tRNA-Met
    111. Saccharomyces cerevisiae YJM996 tRNA-Met
    112. Saccharomyces kudriavzevii IFO 1802 tRNA
    113. Saccharomyces pastorianus tRNA-Met
    114. Torulaspora globosa tRNA-Met
    115. Torulaspora sp. CBS 2947 tRNA-Met
    116. Vanderwaltozyma polyspora DSM 70294 tRNA
    2D structure New