Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-211-5p URS00001A3555_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-204: Hsa-mir-204 is a microRNA that has been studied in various contexts. It has been found that the decreased expression of hsa-mir-204 in patients with inflammatory breast cancer (IBC) is expected to increase the level of the transcriptional regulator high mobility group AT-hook protein 2 (HMGA2) [PMC4289319]. Additionally, the regulation of hsa-mir-204 expression may play a role in controlling clear cell renal cell carcinoma (ccRCC) development through mediating the focal adhesion pathway [PMC7405617]. In patients with breast cancer susceptibility gene BRCA, hsa-mir-204 was found to be downregulated and associated with overall survival [PMC9918521]. In vitro functional analyses have shown that hsa-mir-204 is involved in inhibiting clonogenic growth, migration, and invasion of endometrial carcinoma cells [PMC4918724]. Furthermore, hsa-mir-204 has been identified as one of several microRNAs associated with different stages and types of gastric cancer [PMC4496000]. Overall, these studies highlight the importance of hsa-mir-204 in various cancer types and its potential as a therapeutic target.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCCCUUUGUCAUCCUUCGCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Macaca nemestrina (pig-tailed macaque) mne-miR-211
  2. Pan troglodytes ptr-miR-211
  3. Pongo pygmaeus ppy-miR-211
Publications