Caenorhabditis brenneri cbn-miR-46

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Caenorhabditis brenneri cbn-miR-46 URS000019A951_135651

22 nucleotides
1 database (miRBase)
Found in 4 other species
1 publications

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UGUCAUGGAGUCGCUCUCUUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

Caenorhabditis briggsae cbr-miR-46
Caenorhabditis elegans cel-miR-46-3p
Haemonchus contortus (barber pole worm) hco-miR-46
Heligmosomoides polygyrus hpo-miR-46-3p

Publications