Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Vibrio campbellii 5S ribosomal RNA secondary structure diagram

Vibrio campbellii 5S ribosomal RNA URS000019A275_680

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUUGGCGACCAUAGCGAUUUGGACCCACCUGACUUCCAUUCCGAACUCAGAAGUGAAACGAAUUAGCGCCGAUGGUAGUGUGGGCUUCCCCAUGUGAGAGUAGGACAUCGCCAGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Vibrio campbellii CAIM 519 = NBRC 15631 = ATCC 25920 5S ribosomal RNA
  2. Vibrio campbellii ATCC BAA-1116 5S ribosomal RNA
2D structure