v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Arabidopsis lyrata subsp. lyrata (lyrate rockcress) small nucleolar RNA Z43 secondary structure diagram

Arabidopsis lyrata subsp. lyrata (lyrate rockcress) small nucleolar RNA Z43 URS000019A0C9_81972

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGACAGUGACGAUUGAUAUUAAGGUCUCGUUCGUCGUAAAAACGGCCGUAAAAAGCCUAUUUGCCGACCAUUCUGUUAUAUCACCACCCAUAUUCUGAGUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Arabidopsis halleri subsp. gemmifera small nucleolar RNA Z43
  2. Arabidopsis suecica snoZ43
  3. Arabidopsis thaliana ncRNA (AT3G24615)
  4. Arabidopsis thaliana x Arabidopsis arenosa snoZ43
 2D structure Publications