Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-1187 URS0000199A33_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-1187: Mmu-mir-1187 is a miRNA that has been identified as one of the main different miRNAs in a study [PMC9686084]. It is classified as a miRNA based on its nomenclature, which indicates that it is derived from the mouse genome [PMC9686084]. In addition to mmu-mir-1187, other miRNAs such as mmu-miR-574-5p, mmu-miR-466hj, mmu-miR-325-3p, mmu-miR-465b-5p, and mmu-miR-465f-5p were also found to be differentially expressed [PMC9686084]. Another study identified mmu-mir-1187 as one of the top two miRNAs with high degree in a network analysis [PMC7810567]. Furthermore, in the same study, it was found that mmu-mir-1187 was one of the most down-regulated miRNAs [PMC3861310]. The potential targets of mmu-mir-1187 were found to include other miRNAs such as mmu-miR466j and mmu-miR669m5p [PMC5689704]. In addition to its role as a differentially expressed and down-regulated miRNA, it has also been identified as a potential binding target for circRNAs such as mmucircRNA40001 and mmcircRNA013120 [PMC5689704].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAUGUGUGUGUGUAUGUGUGUAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications