Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-15a-3p URS00001989EA_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-15a: Mmu-mir-15a is a type of microRNA that has been investigated in various studies. Real-time PCR was used to examine the expression of mmu-mir-15a in the brain tissue of mice [PMC5544724]. TaqMan Assays were used for quantitation, including mmu-mir-15a [PMC4508006]. Mmu-mir-15a has been found to suppress the expression of Mlycd [PMC3692539]. It has also been associated with IRF and joint target genes [PMC7074395]. Mmu-mir-15a has been implicated in the inhibition of IL-17 production and its role in offspring thymic expression [PMC8234718]. Additionally, mmu-mir-15a has been studied in relation to key genes and microRNAs involved in various biological processes [PMC6781998]. In some studies, mmu-mir-15a was found to be downregulated in certain conditions, such as DIO mice [PMC4571067]. It is also involved in the regulation of cell proliferation and apoptosis [PMC2244641]. The concentration of Taqman probe for mmu-mir-15a was 200 nM [PMC5425121]. References: [PMC5544724] [PMC4508006] [PMC3692539] [PMC7074395] [PMC8234718] [PMC6781998] [PM4571067] [PM2244641] [PM5425121]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGGCCAUACUGUGCUGCCUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications