Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-485-5p URS00001935FA_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (miRBase, LncBase, RefSeq, TarBase, PSICQUIC, ENA, MalaCards, GeneCards). Described in 50 papers. Homo sapiens (human) hsa-miR-485-5p sequence is a product of MIR-RG-102, hsa-miR-485-5p, miR-485, miR-485-5p, MIR485, HSA-MIR-RG-102, hsa-miR-485 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 12CC4, 16.3A5, 182-FIP, 4.1-G, 4.1G, 82-FIP, A2D, A2lp, ABBA, ABBA-1.

Interactions 4

According to PSICQUIC, Homo sapiens (human) hsa-miR-485-5p interacts with:

Interaction id Participant Synonyms
URS00001935FA_9606-0 P56817 P56817
URS00001935FA_9606-2 P56817 P56817
URS00001935FA_9606-1 Q14790 Q14790
URS00001935FA_9606-3 Q14790 Q14790

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AGAGGCUGGCCGUGAUGAAUUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 14 other species

    1. Capra hircus chi-miR-485-5p
    2. Dasypus novemcinctus (nine-banded armadillo) dno-miR-485-5p
    3. Equus caballus (horse) eca-miR-485-5p
    4. Macaca mulatta mml-miR-485-5p
    5. Mus musculus (house mouse) mmu-miR-485-5p
    6. Pan paniscus ppa-miR-485
    7. Pongo pygmaeus ppy-miR-485-5p
    8. Pteropus alecto pal-miR-485-5p
    9. Rattus norvegicus rno-miR-485-5p