Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Macaca mulatta (Rhesus monkey) mml-miR-544 URS00001934CD_9544

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUUCUGCAUUUUUAGCAAGUUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

  1. Bos taurus bta-miR-544a
  2. Callithrix jacchus cja-miR-544
  3. Canis lupus familiaris cfa-miR-544
  4. Equus caballus eca-miR-544
  5. Homo sapiens (human) hsa-miR-544a
  6. Pan troglodytes (chimpanzee) ptr-miR-544
  7. Pongo pygmaeus (Bornean orangutan) ppy-miR-544
Publications