Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-483 precursor URS000018B0EE_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR483: In summary, using Cas9 immunoprecipitation we identified the oncogenic MIR483 as a critical component in the regulatory complex of IGF2 imprinting [PMC5470959]. In the present study, MIR483 was discovered to be highly expressed in the tissues of patients with BPD and may be involved in bronchial mucosal necrosis and poor repair after injury [PMC9061009]. To evaluate the phenotypic effects of MIR483 downregulation, the proliferation rate of the MIR483−/− C2C12 cells was measured in both Igf2+/+ and Igf2dGGCT cells, where the ZBED6-Igf2 axis is disrupted [PMC8484269].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAGGGGGAAGACGGGAGGAAAGAAGGGAGUGGUUCCAUCACGCCUCCUCACUCCUCUCCUCCCGUCUUCUCCUCUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Publications