Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Cellulomonas humilata 5S ribosomal RNA secondary structure diagram

Cellulomonas humilata 5S ribosomal RNA URS0000189911_144055

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACGGCGGUCAUAGCGAAGGGGAAACGCCCGGUCCCAUUCCGAACCCGGAAGCUAAGCCCUUCAGCGCCGAUGGUACUGCACUCGCCAGGGUGUGGGAGAGUAGGACGCCGCCGGAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 27 other species

  1. Cellulomonas biazotea 5S ribosomal RNA
  2. Cellulomonas denverensis 5S ribosomal RNA
  3. Cellulomonas fimi 5S rRNA
  4. Cellulomonas fimi ATCC 484 5S ribosomal RNA
  5. Cellulomonas flavigena 5S rRNA
  6. Cellulomonas flavigena DSM 20109 5S ribosomal RNA
  7. Cellulomonas gilvus ATCC 13127 5S ribosomal RNA
  8. Cellulomonas hominis 5S ribosomal RNA
  9. Cellulomonas iranensis 5S ribosomal RNA
  10. Cellulomonas septica 5S ribosomal RNA
  11. Cellulomonas soli 5S ribosomal RNA
  12. Cellulomonas sp. 5S ribosomal RNA
  13. Cellulomonas sp. A375-1 5S ribosomal RNA
  14. Cellulomonas sp. B6 5S ribosomal RNA
  15. Cellulomonas fulva 5S ribosomal RNA
  16. Cellulomonas sp. ES6 5S ribosomal RNA
  17. Cellulomonas sp. H30R-01 5S ribosomal RNA
  18. Cellulomonas sp. HD19AZ1 5S ribosomal RNA
  19. Cellulomonas sp. JZ18 5S ribosomal RNA
  20. Cellulomonas sp. Leaf334 5S ribosomal RNA
  21. Cellulomonas sp. Leaf395 5S ribosomal RNA
  22. Cellulomonas sp. PSBB021 5S ribosomal RNA
  23. Cellulomonas sp. Root137 5S ribosomal RNA
  24. Cellulomonas sp. Root485 5S ribosomal RNA
  25. Cellulomonas sp. Root930 5S ribosomal RNA
  26. Cellulomonas fengjieae 5S ribosomal RNA
  27. Cellulomonas fengjieae 5S ribosomal RNA
  28. Cellulomonas gilvus [Cellvibrio] gilvus 5S rRNA
2D structure