Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Glossina pallidipes (tsetse fly) Gpa-Mir-1175_3p (mature (guide)) URS0000187D5B_7398

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGAUUCUUCUAUUCUACUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Cochliomyia hominivorax (primary screw-worm) mature cho-miR-958
  2. Cochliomyia macellaria mature cma-miR-958
  3. Drosophila ananassae Dan-Mir-1175_3p (mature (guide))
  4. Drosophila melanogaster dme-miR-958-3p
  5. Drosophila mojavensis Dmo-Mir-1175_3p* (star (passenger))
  6. Drosophila pseudoobscura dps-miR-958-3p
  7. Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0330898_df_nrg
  8. Drosophila simulans dsi-miR-958-3p
  9. Drosophila virilis dvi-miR-958-3p
  10. Drosophila yakuba Dya-Mir-1175-P4_3p (mature (guide))
Relationships

Molecular Relationships