Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Taeniopygia guttata (zebra finch) tgu-miR-23-3p URS0000183BED_59729

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUCACAUUGCCAGGGAUUACC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 29 other species

  1. Anolis carolinensis aca-miR-23b-3p
  2. Callithrix jacchus cja-miR-23b
  3. Callorhinchus milii (elephant shark) eshark_mir-23_1
  4. Capra hircus chi-miR-23b-3p
  5. Chiloscyllium plagiosum microRNA cpl-miR-23b
  6. Chrysemys picta (Painted turtle) cpi-miR-23b-3p
  7. Cricetulus griseus cgr-miR-23b-3p
  8. Cyprinus carpio ccr-miR-23b
  9. Daubentonia madagascariensis dma-miR-23b
  10. Equus caballus (horse) eca-miR-23b
  11. Gallus gallus (chicken) gga-miR-23b-3p
  12. Haplochromis burtoni abu-miR-23b
  13. Homo sapiens hsa-miR-23b-3p
  14. Ictalurus punctatus ipu-miR-23b
  15. Macaca mulatta mml-miR-23b-3p
  16. Maylandia zebra (zebra mbuna) mze-miR-23b
  17. Microcebus murinus mmr-miR-23b
  18. Monodelphis domestica mdo-miR-23b-3p
  19. Mus musculus (house mouse) mmu-miR-23b-3p
  20. Neolamprologus brichardi nbr-miR-23b
  21. Nomascus leucogenys nle-miR-23b
  22. Oreochromis niloticus (Nile tilapia) oni-miR-23b
  23. Ovis aries miscellaneous RNA
  24. Papio hamadryas pha-miR-23b
  25. Pundamilia nyererei pny-miR-23b
  26. Rattus norvegicus (Norway rat) rno-miR-23b-3p
  27. Tursiops truncatus miR-23b
  28. Xenopus laevis xla-miR-23b-3p
  29. Xenopus tropicalis xtr-miR-23b
Publications