Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Escherichia coli BW25113 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1) secondary structure diagram

Escherichia coli BW25113 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1) URS0000181AEC_679895

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCCGAAGUGGCGAAAUCGGUAGACGCAGUUGAUUCAAAAUCAACCGUAGAAAUACGUGCCGGUUCGAGUCCGGCCUUCGGCACCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5,442 other species

  1. Escherichia coli tRNA-Leu(caa)
  2. Acinetobacter baumannii tRNA-Leu
  3. Atlantibacter hermannii tRNA-Leu
  4. Atlantibacter sp. RC6 tRNA-Leu
  5. Atlantibacter subterranea tRNA-Leu
  6. Bacteriophage sp. tRNA-Leu
  7. Bacteroides sp. tRNA-Leu
  8. Brenneria bubanii tRNA-Leu
  9. Brenneria goodwinii tRNA-Leu
  10. Brenneria izbisi tRNA-Leu
  11. Brenneria nigrifluens DSM 30175 = ATCC 13028 tRNA-Leu
  12. Brenneria nigrifluens tRNA-Leu
  13. Brenneria rubrifaciens tRNA-Leu
  14. Brenneria salicis ATCC 15712 = DSM 30166 tRNA-Leu
  15. Brenneria sp. CFCC 11842 tRNA-Leu
  16. Brenneria sp. EniD312 tRNA-Leu
  17. Brenneria izadpanahii tRNA-Leu
  18. Brenneria sp. L3-3C-1 tRNA-Leu
  19. Cedecea colo tRNA-Leu
  20. Cedecea lapagei tRNA-Leu
  21. Cedecea neteri tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  22. Chania multitudinisentens RB-25 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  23. Citrobacter amalonaticus tRNA-Leu
  24. Citrobacter amalonaticus Y19 tRNA-Leu
  25. Citrobacter farmeri GTC 1319 tRNA-Leu
  26. Citrobacter farmeri tRNA-Leu
  27. Citrobacter freundii tRNA-Leu
  28. Citrobacter koseri ATCC BAA-895 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  29. Citrobacter koseri tRNA-Leu
  30. Citrobacter rodentium ICC168 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  31. Citrobacter rodentium tRNA-Leu
  32. Citrobacter sedlakii tRNA-Leu
  33. Citrobacter sp. 50677481 tRNA-Leu
  34. Citrobacter sp. BDA59-3 tRNA-Leu
  35. Citrobacter sp. Ca225 tRNA-Leu
  36. Citrobacter sp. Ca226 tRNA-Leu
  37. Citrobacter sp. CFNIH10 tRNA-Leu
  38. Citrobacter sp. CK180 tRNA-Leu
  39. Citrobacter sp. CK181 tRNA-Leu
  40. Citrobacter sp. CK182 tRNA-Leu
  41. Citrobacter sp. CK183 tRNA-Leu
  42. Citrobacter sp. CK184 tRNA-Leu
  43. Citrobacter sp. CK185 tRNA-Leu
  44. Citrobacter sp. CK186 tRNA-Leu
  45. Citrobacter sp. CK187 tRNA-Leu
  46. Citrobacter sp. CK188 tRNA-Leu
  47. Citrobacter sp. CK189 tRNA-Leu
  48. Citrobacter sp. CK190 tRNA-Leu
  49. Citrobacter sp. CK191 tRNA-Leu
  50. Citrobacter sp. CK192 tRNA-Leu
  51. Citrobacter sp. CK193 tRNA-Leu
  52. Citrobacter sp. CK194 tRNA-Leu
  53. Citrobacter sp. CK195 tRNA-Leu
  54. Citrobacter sp. CK196 tRNA-Leu
  55. Citrobacter sp. CK197 tRNA-Leu
  56. Citrobacter sp. CK198 tRNA-Leu
  57. Citrobacter sp. CK199 tRNA-Leu
  58. Citrobacter sp. CK200 tRNA-Leu
  59. Citrobacter sp. CK201 tRNA-Leu
  60. Citrobacter sp. CK202 tRNA-Leu
  61. Citrobacter sp. CK203 tRNA-Leu
  62. Citrobacter sp. CK204 tRNA-Leu
  63. Citrobacter sp. CK205 tRNA-Leu
  64. Citrobacter sp. CK206 tRNA-Leu
  65. Citrobacter sp. CK207 tRNA-Leu
  66. Citrobacter sp. Cs237 tRNA-Leu
  67. Citrobacter sp. Ct235 tRNA-Leu
  68. Citrobacter sp. JGM124 tRNA-Leu
  69. Citrobacter sp. MGH 55 tRNA-Leu
  70. Citrobacter sp. NCU1 tRNA-Leu
  71. Citrobacter telavivensis tRNA-Leu
  72. Citrobacter sp. R56 tRNA-Leu
  73. Citrobacter sp. RHB20-C15 tRNA-Leu
  74. Citrobacter sp. RHB20-C16 tRNA-Leu
  75. Citrobacter sp. RHB21-C01 tRNA-Leu
  76. Citrobacter sp. RHB21-C05 tRNA-Leu
  77. Citrobacter sp. RHB35-C17 tRNA-Leu
  78. Citrobacter sp. S171 tRNA-Leu
  79. Citrobacter sp. S2-9 tRNA-Leu
  80. Citrobacter sp. T1.2D-1 tRNA-Leu(caa)
  81. Citrobacter sp. TBCP-5362 tRNA-Leu
  82. Citrobacter sp. Y3 tRNA-Leu
  83. Citrobacter telavivensis tRNA-Leu
  84. Citrobacter youngae tRNA-Leu
  85. compost metagenome tRNA-Leu
  86. Cronobacter sakazakii tRNA-Leu
  87. Culicoides impunctatus tRNA-Leu(caa)
  88. Dialister sp. tRNA-Leu
  89. Dickeya chrysanthemi Ech1591 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  90. Dickeya chrysanthemi tRNA-Leu
  91. Dickeya dadantii 3937 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  92. Dickeya dadantii tRNA-Leu
  93. Dickeya dianthicola RNS04.9 tRNA-Leu
  94. Dickeya dianthicola tRNA-Leu
  95. Dickeya fangzhongdai tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  96. Dickeya lacustris tRNA-Leu
  97. Dickeya oryzae tRNA-Leu
  98. Dickeya parazeae Ech586 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  99. Dickeya solani D s0432-1 tRNA-Leu
  100. Dickeya solani IPO 2222 tRNA-Leu
  101. Dickeya solani RNS 08.23.3.1.A tRNA-Leu
  102. Dickeya solani tRNA-Leu
  103. Dickeya sp. CFBP 2040 tRNA-Leu
  104. Dickeya undicola tRNA-Leu
  105. Dickeya undicola tRNA-Leu
  106. Dickeya poaceiphila tRNA-Leu
  107. Dickeya sp. ws52 tRNA-Leu
  108. Dickeya zeae EC1 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  109. Dickeya zeae tRNA-Leu
  110. Dryocola boscaweniae tRNA-Leu
  111. Edwardsiella anguillarum ET080813 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  112. Edwardsiella anguillarum tRNA-Leu
  113. Edwardsiella hoshinae tRNA-Leu(caa)
  114. Edwardsiella ictaluri 93-146 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  115. Edwardsiella ictaluri tRNA-Leu
  116. Edwardsiella piscicida tRNA-Leu
  117. Edwardsiella sp. EA181011 tRNA-Leu
  118. Edwardsiella sp. LADL05-105 tRNA-Leu
  119. Edwardsiella tarda ATCC 15947 = NBRC 105688 tRNA-Leu
  120. Edwardsiella tarda ATCC 23685 tRNA-Leu
  121. Edwardsiella tarda tRNA-Leu(caa)
  122. Enterobacillus tribolii tRNA-Leu
  123. Enterobacterales bacterium CwR94 tRNA-Leu
  124. Enterobacterales bacterium tRNA-Leu
  125. Enterobacter asburiae L1 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  126. Enterobacter asburiae (uncultured bacterium metagenome) tRNA-Leu
  127. Enterobacter bugandensis tRNA-Leu
  128. Enterobacter cancerogenus ATCC 35316 tRNA-Leu
  129. Enterobacter cancerogenus Leu tRNA
  130. Enterobacter chengduensis tRNA-Leu
  131. Enterobacter chuandaensis tRNA-Leu
  132. Enterobacter cloacae BIDMC 33A tRNA-Leu
  133. Enterobacter cloacae BIDMC 66 tRNA-Leu
  134. Enterobacter cloacae BIDMC 67 tRNA-Leu
  135. Enterobacter cloacae BIDMC 8 tRNA-Leu
  136. Enterobacter cloacae BWH 29 tRNA-Leu
  137. Enterobacter cloacae BWH 31 tRNA-Leu
  138. Enterobacter cloacae BWH 43 tRNA-Leu
  139. Enterobacter cloacae complex sp. 2022EL-00747 tRNA-Leu
  140. Enterobacter cloacae complex sp. 2022EL-00759 tRNA-Leu
  141. Enterobacter cloacae complex sp. 2022EL-00787 tRNA-Leu
  142. Enterobacter cloacae complex sp. 2022EL-00788 tRNA-Leu
  143. Enterobacter cloacae complex sp. 2023EL-00493 tRNA-Leu
  144. Enterobacter cloacae complex sp. 2DZ2F16B1 tRNA-Leu
  145. Enterobacter cloacae complex sp. 2DZ2F20B tRNA-Leu
  146. Enterobacter cloacae complex sp. 2DZ2F2B tRNA-Leu
  147. Enterobacter cloacae complex sp. 3DZ3S2B tRNA-Leu
  148. Enterobacter cloacae complex sp. 4DZ1-17B1 tRNA-Leu
  149. Enterobacter cloacae complex sp. 4DZ3-17B2 tRNA-Leu
  150. Enterobacter cloacae complex sp. 4DZ3-28B tRNA-Leu
  151. Enterobacter cloacae complex sp. 677-3DZ2D5B tRNA-Leu
  152. Enterobacter cloacae complex sp. 742-ADZ3-9B tRNA-Leu
  153. Enterobacter cloacae complex sp. 743-2DZ2F-22B tRNA-Leu
  154. Enterobacter cloacae complex sp. AR_0002 tRNA-Leu
  155. Enterobacter cloacae complex sp. CH23B tRNA-Leu
  156. Enterobacter cloacae complex sp. EB5 tRNA-Leu
  157. Enterobacter cloacae complex sp. ECNIH10 tRNA-Leu
  158. Enterobacter cloacae complex sp. ECNIH11 tRNA-Leu
  159. Enterobacter cloacae complex sp. ECNIH13 tRNA-Leu
  160. Enterobacter cloacae complex sp. ECNIH14 tRNA-Leu
  161. Enterobacter cloacae complex sp. ECNIH15 tRNA-Leu
  162. Enterobacter cloacae complex sp. ECNIH16 tRNA-Leu
  163. Enterobacter cloacae complex sp. ECNIH6 tRNA-Leu
  164. Enterobacter cloacae complex sp. ECNIH7 tRNA-Leu
  165. Enterobacter cloacae complex sp. ECNIH8 tRNA-Leu
  166. Enterobacter cloacae complex sp. ECNIH9 tRNA-Leu
  167. Enterobacter cloacae complex sp. FDA-CDC-AR_0132 tRNA-Leu
  168. Enterobacter cloacae complex sp. FDA-CDC-AR_0164 tRNA-Leu
  169. Enterobacter cloacae complex sp. GF14B tRNA-Leu
  170. Enterobacter cloacae complex sp. I10 tRNA-Leu
  171. Enterobacter cloacae complex sp. I11 tRNA-Leu
  172. Enterobacter cloacae complex sp. I1M tRNA-Leu
  173. Enterobacter cloacae complex sp. I1 tRNA-Leu
  174. Enterobacter cloacae complex sp. I3 tRNA-Leu
  175. Enterobacter cloacae complex sp. I4 tRNA-Leu
  176. Enterobacter cloacae complex sp. I5 tRNA-Leu
  177. Enterobacter cloacae complex sp. I6 tRNA-Leu
  178. Enterobacter cloacae complex sp. I7 tRNA-Leu
  179. Enterobacter cloacae complex sp. I8 tRNA-Leu
  180. Enterobacter cloacae complex sp. I9 tRNA-Leu
  181. Enterobacter cloacae complex sp. P12RS tRNA-Leu
  182. Enterobacter cloacae complex sp. P14RS tRNA-Leu
  183. Enterobacter cloacae complex sp. P15RS tRNA-Leu
  184. Enterobacter cloacae complex sp. P16RS2 tRNA-Leu
  185. Enterobacter cloacae complex sp. P17RS tRNA-Leu
  186. Enterobacter cloacae complex sp. P20B tRNA-Leu
  187. Enterobacter cloacae complex sp. P20C tRNA-Leu
  188. Enterobacter cloacae complex sp. P21C tRNA-Leu
  189. Enterobacter cloacae complex sp. P21RS tRNA-Leu
  190. Enterobacter cloacae complex sp. P22RS tRNA-Leu
  191. Enterobacter cloacae complex sp. P23RS tRNA-Leu
  192. Enterobacter cloacae complex sp. P25RS tRNA-Leu
  193. Enterobacter cloacae complex sp. P26RS tRNA-Leu
  194. Enterobacter cloacae complex sp. P27C tRNA-Leu
  195. Enterobacter cloacae complex sp. P28RS tRNA-Leu
  196. Enterobacter cloacae complex sp. P29RS tRNA-Leu
  197. Enterobacter cloacae complex sp. P2B tRNA-Leu
  198. Enterobacter cloacae complex sp. P30BA tRNA-Leu
  199. Enterobacter cloacae complex sp. P30U tRNA-Leu
  200. Enterobacter cloacae complex sp. P31C tRNA-Leu
  201. Enterobacter cloacae complex sp. P32C tRNA-Leu
  202. Enterobacter cloacae complex sp. P33B tRNA-Leu
  203. Enterobacter cloacae complex sp. P34C tRNA-Leu
  204. Enterobacter cloacae complex sp. P38RS tRNA-Leu
  205. Enterobacter cloacae complex sp. P40C2 tRNA-Leu
  206. Enterobacter cloacae complex sp. P42C tRNA-Leu
  207. Enterobacter cloacae complex sp. P43RS tRNA-Leu
  208. Enterobacter cloacae complex sp. P44RS tRNA-Leu
  209. Enterobacter cloacae complex sp. P46RS tRNA-Leu
  210. Enterobacter cloacae complex sp. P47BA tRNA-Leu
  211. Enterobacter cloacae complex sp. P6RS tRNA-Leu
  212. Enterobacter cloacae complex sp. P8BA tRNA-Leu
  213. Enterobacter cloacae complex sp. P9RS tRNA-Leu
  214. Enterobacter cloacae complex sp. TREC1 tRNA-Leu
  215. Enterobacter cloacae complex sp. tRNA-Leu
  216. Enterobacter cloacae ECNIH2 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  217. Enterobacter cloacae MGH 53 tRNA-Leu
  218. Enterobacter cloacae str. Hanford tRNA-Leu
  219. Enterobacter cloacae subsp. cloacae ATCC 13047 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  220. Enterobacter cloacae subsp. cloacae GS1 tRNA-Leu
  221. Enterobacter cloacae subsp. cloacae tRNA-Leu
  222. Enterobacter cloacae subsp. dissolvens SDM tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  223. Enterobacter cloacae subsp. dissolvens tRNA-Leu
  224. Enterobacter cloacae tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  225. Enterobacter cloacae UCI 23 tRNA-Leu
  226. Enterobacter cloacae UCI 24 tRNA-Leu
  227. Enterobacter cloacae UCI 29 tRNA-Leu
  228. Enterobacter cloacae UCI 30 tRNA-Leu
  229. Enterobacter cloacae UCI 35 tRNA-Leu
  230. Enterobacter cloacae UCI 36 tRNA-Leu
  231. Enterobacter cloacae UCI 49 tRNA-Leu
  232. Enterobacter cloacae UCICRE 11 tRNA-Leu
  233. Enterobacter cloacae UCICRE 12 tRNA-Leu
  234. Enterobacter cloacae UCICRE 5 tRNA-Leu
  235. Enterobacter dykesii tRNA-Leu
  236. Enterobacter genomosp. O tRNA-Leu
  237. Enterobacter genomosp. S tRNA-Leu
  238. Enterobacter hormaechei ATCC 49162 tRNA-Leu
  239. Enterobacter hormaechei subsp. hoffmannii MRSN 11248 tRNA-Leu
  240. Enterobacter hormaechei subsp. hoffmannii tRNA-Leu
  241. Enterobacter hormaechei subsp. hoffmannii UCI 50 tRNA-Leu
  242. Enterobacter hormaechei subsp. hoffmannii UCICRE 3 tRNA-Leu
  243. Enterobacter hormaechei subsp. hoffmannii UCICRE 9 tRNA-Leu
  244. Enterobacter hormaechei subsp. hormaechei tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  245. Enterobacter hormaechei subsp. oharae tRNA-Leu
  246. Enterobacter hormaechei subsp. steigerwaltii tRNA-Leu
  247. Enterobacter hormaechei subsp. xiangfangensis tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  248. Enterobacter hormaechei tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  249. Enterobacter huaxiensis tRNA-Leu
  250. Enterobacteriaceae bacterium 4M9 tRNA-Leu
  251. Enterobacteriaceae bacterium 8376wB8 tRNA-Leu
  252. Enterobacteriaceae bacterium 8376wB9 tRNA-Leu
  253. Enterobacteriaceae bacterium 8376wD7 tRNA-Leu
  254. Enterobacteriaceae bacterium 8376wD8 tRNA-Leu
  255. Enterobacteriaceae bacterium 8376wD9 tRNA-Leu
  256. Enterobacteriaceae bacterium 8376wG6 tRNA-Leu
  257. Enterobacteriaceae bacterium A-F18 tRNA-Leu
  258. Enterobacteriaceae bacterium ATCC 29904 tRNA-Leu
  259. Enterobacteriaceae bacterium BIT-l23 tRNA-Leu
  260. Enterobacteriaceae bacterium CCUG 67584 tRNA-Leu
  261. Enterobacteriaceae bacterium ENNIH1 tRNA-Leu
  262. Enterobacteriaceae bacterium RIT691 tRNA-Leu
  263. Enterobacteriaceae bacterium RIT714 tRNA-Leu
  264. Enterobacteriaceae bacterium S05 tRNA-Leu
  265. Enterobacteriaceae bacterium S29_ASV_15 tRNA-Leu
  266. Enterobacteriaceae bacterium strain FGI 57 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  267. Enterobacteriaceae bacterium tRNA-Leu
  268. Enterobacteriaceae bacterium TzEc013 tRNA-Leu
  269. Enterobacteriaceae bacterium TzEc051 tRNA-Leu
  270. Enterobacteriaceae bacterium TzEc077 tRNA-Leu
  271. Enterobacteriaceae bacterium TzEc084 tRNA-Leu
  272. Enterobacter kobei tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  273. Enterobacter ludwigii tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  274. Enterobacter mori tRNA-Leu
  275. Enterobacter nematophilus tRNA-Leu
  276. Enterobacter pseudoroggenkampii tRNA-Leu
  277. Enterobacter quasiroggenkampii tRNA-Leu
  278. Enterobacter roggenkampii CHS 79 tRNA-Leu
  279. Enterobacter roggenkampii EC_38VIM1 tRNA-Leu
  280. Enterobacter roggenkampii MGH 34 tRNA-Leu
  281. Enterobacter roggenkampii MGH 54 tRNA-Leu
  282. Enterobacter roggenkampii tRNA-Leu
  283. Enterobacter roggenkampii UCI 39 tRNA-Leu
  284. Enterobacter sichuanensis tRNA-Leu
  285. Enterobacter soli ATCC BAA-2102 tRNA-Leu
  286. Enterobacter soli tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  287. Enterobacter sp. 155105 tRNA-Leu
  288. Enterobacter sp. 18A13 tRNA-Leu
  289. Enterobacter sp. 198 tRNA-Leu
  290. Enterobacter sp. 200527-13 tRNA-Leu
  291. Enterobacter sp. 301B tRNA-Leu
  292. Enterobacter sp. 50588862 tRNA-Leu
  293. Enterobacter sp. 50793107 tRNA-Leu
  294. Enterobacter sp. 50858885 tRNA-Leu
  295. Enterobacter sp. 56-7 tRNA-Leu
  296. Enterobacter sp. 638 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  297. Enterobacter sp. 9-2 tRNA-Leu
  298. Enterobacter sp. A11 tRNA-Leu
  299. Enterobacter sp. AD2-3 tRNA-Leu
  300. Enterobacter sp. Ag1 tRNA-Leu
  301. Enterobacter sp. AM17-18 tRNA-Leu
  302. Enterobacter sp. Ap-916 tRNA-Leu
  303. Enterobacter sp. AS-1 tRNA-Leu
  304. Enterobacter sp. BIDMC100 tRNA-Leu
  305. Enterobacter sp. BIDMC109 tRNA-Leu
  306. Enterobacter sp. BIDMC 26 tRNA-Leu
  307. Enterobacter sp. BIDMC 27 tRNA-Leu
  308. Enterobacter sp. BIDMC 28 tRNA-Leu
  309. Enterobacter sp. BIDMC 29 tRNA-Leu
  310. Enterobacter sp. BIDMC 30 tRNA-Leu
  311. Enterobacter sp. BIDMC87 tRNA-Leu
  312. Enterobacter sp. BIDMC92 tRNA-Leu
  313. Enterobacter sp. BIDMC93 tRNA-Leu
  314. Enterobacter sp. BIDMC94 tRNA-Leu
  315. Enterobacter sp. BIDMC99 tRNA-Leu
  316. Enterobacter sp. BWH 27 tRNA-Leu
  317. Enterobacter sp. BWH 37 tRNA-Leu
  318. Enterobacter sp. BWH 39 tRNA-Leu
  319. Enterobacter sp. BWH52 tRNA-Leu
  320. Enterobacter sp. BWH63 tRNA-Leu
  321. Enterobacter sp. BWH64 tRNA-Leu
  322. Enterobacter sp. C6 tRNA-Leu
  323. Enterobacter sp. CGMCC 5087 tRNA-Leu
  324. Enterobacter sp. CP102 tRNA-Leu
  325. Enterobacter sp. Crenshaw tRNA-Leu
  326. Enterobacter sp. CRENT-193 tRNA-Leu
  327. Enterobacter sp. DC1 tRNA-Leu
  328. Enterobacter sp. DC3 tRNA-Leu
  329. Enterobacter sp. DC4 tRNA-Leu
  330. Enterobacter sp. DNRA5 tRNA-Leu
  331. unidentified tRNA-Leu
  332. Enterobacter sp. E12 tRNA-Leu
  333. Enterobacter sp. E20 tRNA-Leu
  334. Enterobacter sp. E76 tRNA-Leu
  335. Enterobacter sp. EA-1 tRNA-Leu
  336. Enterobacter sp. EC_62 tRNA-Leu
  337. Enterobacter sp. EC-ML559 tRNA-Leu
  338. Enterobacter sp. EC-ML 621 tRNA-Leu
  339. Enterobacter sp. EC-NT1 tRNA-Leu
  340. Enterobacter sp. EGD-HP1 tRNA-Leu
  341. Enterobacter sp. ENT02 tRNA-Leu
  342. Enterobacter sp. FB tRNA-Leu
  343. Enterobacter sp. FS01 tRNA-Leu
  344. Enterobacter sp. FY-07 tRNA-Leu
  345. Enterobacter sp. GD03975 tRNA-Leu
  346. Enterobacter sp. GER_MD16_1505_Eko_090 tRNA-Leu
  347. Enterobacter sp. HK169 tRNA-Leu
  348. Enterobacter sp. HMSC16D10 tRNA-Leu
  349. Enterobacter sp. HN503E2II tRNA-Leu
  350. Enterobacter sp. HPCN14 tRNA-Leu
  351. Enterobacter sp. HSTU-ASh6 tRNA-Leu
  352. Enterobacter sp. J49 tRNA-Leu
  353. Enterobacter sp. JGM127 tRNA-Leu
  354. Enterobacter sp. JUb54 tRNA-Leu
  355. Enterobacter sp. K66-74 tRNA-Leu
  356. Enterobacter sp. ku-bf2 tRNA-Leu
  357. Enterobacter sp. LR6 tRNA-Leu
  358. Enterobacter sp. LU1 tRNA-Leu
  359. Enterobacter sp. M4-VN tRNA-Leu
  360. Enterobacter sp. MF024 tRNA-Leu
  361. Enterobacter sp. MGH 10 tRNA-Leu
  362. Enterobacter sp. MGH119 tRNA-Leu
  363. Enterobacter sp. MGH 11 tRNA-Leu
  364. Enterobacter sp. MGH120 tRNA-Leu
  365. Enterobacter sp. MGH127 tRNA-Leu
  366. Enterobacter sp. MGH128 tRNA-Leu
  367. Enterobacter sp. MGH 12 tRNA-Leu
  368. Enterobacter sp. MGH 14 tRNA-Leu
  369. Enterobacter sp. MGH 15 tRNA-Leu
  370. Enterobacter sp. MGH 16 tRNA-Leu
  371. Enterobacter sp. MGH 1 tRNA-Leu
  372. Enterobacter sp. MGH 22 tRNA-Leu
  373. Enterobacter sp. MGH 23 tRNA-Leu
  374. Enterobacter sp. MGH 24 tRNA-Leu
  375. Enterobacter sp. MGH 25 tRNA-Leu
  376. Enterobacter sp. MGH 26 tRNA-Leu
  377. Enterobacter sp. MGH 2 tRNA-Leu
  378. Enterobacter sp. MGH 33 tRNA-Leu
  379. Enterobacter sp. MGH 37 tRNA-Leu
  380. Enterobacter sp. MGH 38 tRNA-Leu
  381. Enterobacter sp. MGH 3 tRNA-Leu
  382. Enterobacter sp. MGH 5 tRNA-Leu
  383. Enterobacter sp. MGH 6 tRNA-Leu
  384. Enterobacter sp. MGH 7 tRNA-Leu
  385. Enterobacter sp. MGH85 tRNA-Leu
  386. Enterobacter sp. MGH86 tRNA-Leu
  387. Enterobacter sp. MGH 8 tRNA-Leu
  388. Enterobacter sp. MGH 9 tRNA-Leu
  389. Enterobacter sp. N18-03635 tRNA-Leu
  390. Enterobacter sp. NFIX58 tRNA_Leu_CAA
  391. Enterobacter sp. NFIX59 tRNA_Leu_CAA
  392. Enterobacter sp. NFR05 tRNA_Leu_CAA
  393. Enterobacter sp. ODB01 tRNA-Leu
  394. Enterobacter sp. OLF tRNA-Leu
  395. Enterobacter sp. PN108E5IIB tRNA-Leu
  396. Enterobacter sp. R4-368 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  397. Enterobacter sp. RHBSTW-00175 tRNA-Leu
  398. Enterobacter sp. RHBSTW-00422 tRNA-Leu
  399. Enterobacter sp. RHBSTW-00593 tRNA-Leu
  400. Enterobacter sp. RHBSTW-00901 tRNA-Leu
  401. Enterobacter sp. RHBSTW-00975 tRNA-Leu
  402. Enterobacter sp. RHBSTW-00994 tRNA-Leu
  403. Enterobacter sp. RHBSTW-01064 tRNA-Leu
  404. Enterobacter sp. RIT 418 tRNA-Leu
  405. Enterobacter sp. RIT637 tRNA-Leu
  406. Enterobacter sp. RVSM5a tRNA-Leu
  407. Enterobacter sp. SECR18-0236 tRNA-Leu
  408. Enterobacter sp. SECR19-1250 tRNA-Leu
  409. Enterobacter sp. SES19 tRNA-Leu
  410. Enterobacter sp. SGAir0187 tRNA-Leu
  411. Enterobacter sp. SORGH_AS 287 tRNA-Leu
  412. Enterobacter sp. SST3 tRNA-Leu
  413. Enterobacter sp. ST121:950178628 tRNA-Leu
  414. Enterobacter sp. T2 tRNA-Leu
  415. Enterobacter sp. TF2-1-2 tRNA-Leu
  416. Enterobacter sp. TF5 tRNA-Leu
  417. Enterobacter sp. UCD-UG_FMILLET tRNA-Leu
  418. Enterobacter sp. (wastewater metagenome) tRNA-Leu
  419. Enterobacter sp. WCHEn045836 tRNA-Leu
  420. Enterobacter sp. WCHEn090032 tRNA-Leu
  421. Enterobacter wuhouensis tRNA-Leu
  422. Enterobacter quasihormaechei tRNA-Leu
  423. Enterobacter sp. YSU tRNA-Leu
  424. Enterobacter sp. Z1 tRNA-Leu
  425. Enterobacter vonholyi tRNA-Leu
  426. Enterococcus faecalis tRNA-Leu
  427. Enterococcus gallinarum tRNA-Leu
  428. Enterococcus sp. HPCN38 tRNA-Leu
  429. Erwiniaceae bacterium PD-1 tRNA-Leu
  430. Erwiniaceae bacterium (terrestrial metagenome) tRNA-Leu
  431. Erwinia iniecta tRNA-Leu
  432. Erwinia mallotivora tRNA-Leu
  433. Erwinia psidii tRNA-Leu
  434. Erwinia sp. CPCC 100877 tRNA-Leu
  435. Erwinia sp. OAMSP11 tRNA-Leu
  436. Erwinia sp. OLCASP19 tRNA-Leu
  437. Erwinia sp. OLFS4 tRNA-Leu
  438. Erwinia sp. OLMDSP33 tRNA-Leu
  439. Erwinia sp. OLMTSP26 tRNA-Leu
  440. Erwinia sp. OLSSP12 tRNA-Leu
  441. Erwinia sp. OLTSP20 tRNA-Leu
  442. Erwinia tracheiphila PSU-1 tRNA-Leu
  443. Erwinia tracheiphila tRNA-Leu
  444. Escherichia albertii B156 tRNA-Leu
  445. Escherichia albertii KF1 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  446. Escherichia albertii tRNA-Leu
  447. Escherichia coli 0.1288 tRNA-Leu
  448. Escherichia coli 0.1304 tRNA-Leu
  449. Escherichia coli 042 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  450. Escherichia coli 07798 tRNA-Leu
  451. Escherichia coli 08BKT055439 tRNA-Leu
  452. Escherichia coli 08BKT77219 tRNA-Leu
  453. Escherichia coli 09BKT024447 tRNA-Leu
  454. Escherichia coli 09BKT076207 tRNA-Leu
  455. Escherichia coli 09BKT078844 tRNA-Leu
  456. Escherichia coli 10.0821 tRNA-Leu
  457. Escherichia coli 10.0833 tRNA-Leu
  458. Escherichia coli 10.0869 tRNA-Leu
  459. Escherichia coli 110957 tRNA-Leu
  460. Escherichia coli 1-110-08_S1_C1 tRNA-Leu
  461. Escherichia coli 1-110-08_S1_C2 tRNA-Leu
  462. Escherichia coli 1-110-08_S1_C3 tRNA-Leu
  463. Escherichia coli 1-110-08_S3_C1 tRNA-Leu
  464. Escherichia coli 1-110-08_S3_C2 tRNA-Leu
  465. Escherichia coli 1-110-08_S3_C3 tRNA-Leu
  466. Escherichia coli 1-110-08_S4_C1 tRNA-Leu
  467. Escherichia coli 1-110-08_S4_C2 tRNA-Leu
  468. Escherichia coli 1-110-08_S4_C3 tRNA-Leu
  469. Escherichia coli 113290 tRNA-Leu
  470. Escherichia coli 113302 tRNA-Leu
  471. Escherichia coli 113303 tRNA-Leu
  472. Escherichia coli 1-176-05_S1_C1 tRNA-Leu
  473. Escherichia coli 1-176-05_S1_C2 tRNA-Leu
  474. Escherichia coli 1-176-05_S1_C3 tRNA-Leu
  475. Escherichia coli 1-176-05_S3_C1 tRNA-Leu
  476. Escherichia coli 1-176-05_S3_C2 tRNA-Leu
  477. Escherichia coli 1-176-05_S4_C1 tRNA-Leu
  478. Escherichia coli 1-176-05_S4_C2 tRNA-Leu
  479. Escherichia coli 1-176-05_S4_C3 tRNA-Leu
  480. Escherichia coli 1-182-04_S1_C1 tRNA-Leu
  481. Escherichia coli 1-182-04_S1_C2 tRNA-Leu
  482. Escherichia coli 1-182-04_S1_C3 tRNA-Leu
  483. Escherichia coli 1-182-04_S3_C1 tRNA-Leu
  484. Escherichia coli 1-182-04_S3_C2 tRNA-Leu
  485. Escherichia coli 1-182-04_S3_C3 tRNA-Leu
  486. Escherichia coli 1-182-04_S4_C1 tRNA-Leu
  487. Escherichia coli 1-182-04_S4_C2 tRNA-Leu
  488. Escherichia coli 1-182-04_S4_C3 tRNA-Leu
  489. Escherichia coli 1.2264 tRNA-Leu
  490. Escherichia coli 1-250-04_S1_C1 tRNA-Leu
  491. Escherichia coli 1-250-04_S1_C2 tRNA-Leu
  492. Escherichia coli 1-250-04_S1_C3 tRNA-Leu
  493. Escherichia coli 1-250-04_S3_C1 tRNA-Leu
  494. Escherichia coli 1-250-04_S3_C2 tRNA-Leu
  495. Escherichia coli 1-250-04_S4_C1 tRNA-Leu
  496. Escherichia coli 1-250-04_S4_C2 tRNA-Leu
  497. Escherichia coli 1.2741 tRNA-Leu
  498. Escherichia coli 1303 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  499. Escherichia coli 1-392-07_S1_C1 tRNA-Leu
  500. Escherichia coli 1-392-07_S1_C2 tRNA-Leu
  501. Escherichia coli 1-392-07_S3_C1 tRNA-Leu
  502. Escherichia coli 1-392-07_S3_C2 tRNA-Leu
  503. Escherichia coli 1-392-07_S3_C3 tRNA-Leu
  504. Escherichia coli 1-392-07_S4_C1 tRNA-Leu
  505. Escherichia coli 1-392-07_S4_C2 tRNA-Leu
  506. Escherichia coli 1-392-07_S4_C3 tRNA-Leu
  507. Escherichia coli 14A tRNA-Leu
  508. Escherichia coli 174750 tRNA-Leu
  509. Escherichia coli 174900 tRNA-Leu
  510. Escherichia coli 178200 tRNA-Leu
  511. Escherichia coli 178850 tRNA-Leu
  512. Escherichia coli 178900 tRNA-Leu
  513. Escherichia coli 179100 tRNA-Leu
  514. Escherichia coli 179550 tRNA-Leu
  515. Escherichia coli 180050 tRNA-Leu
  516. Escherichia coli 180200 tRNA-Leu
  517. Escherichia coli 180600 tRNA-Leu
  518. Escherichia coli 1827-70 tRNA-Leu
  519. Escherichia coli 199900.1 tRNA-Leu
  520. Escherichia coli 2-005-03_S1_C1 tRNA-Leu
  521. Escherichia coli 2-005-03_S1_C2 tRNA-Leu
  522. Escherichia coli 2-005-03_S1_C3 tRNA-Leu
  523. Escherichia coli 2-005-03_S3_C1 tRNA-Leu
  524. Escherichia coli 2-005-03_S3_C2 tRNA-Leu
  525. Escherichia coli 2-005-03_S3_C3 tRNA-Leu
  526. Escherichia coli 2-005-03_S4_C1 tRNA-Leu
  527. Escherichia coli 2-005-03_S4_C2 tRNA-Leu
  528. Escherichia coli 2-005-03_S4_C3 tRNA-Leu
  529. Escherichia coli 2-011-08_S1_C1 tRNA-Leu
  530. Escherichia coli 2-011-08_S1_C2 tRNA-Leu
  531. Escherichia coli 2-011-08_S1_C3 tRNA-Leu
  532. Escherichia coli 2-011-08_S3_C1 tRNA-Leu
  533. Escherichia coli 2-011-08_S3_C2 tRNA-Leu
  534. Escherichia coli 2-011-08_S3_C3 tRNA-Leu
  535. Escherichia coli 2-011-08_S4_C1 tRNA-Leu
  536. Escherichia coli 2-011-08_S4_C3 tRNA-Leu
  537. Escherichia coli 201600.1 tRNA-Leu
  538. Escherichia coli 2-052-05_S1_C1 tRNA-Leu
  539. Escherichia coli 2-052-05_S1_C3 tRNA-Leu
  540. Escherichia coli 2-052-05_S3_C1 tRNA-Leu
  541. Escherichia coli 2-052-05_S3_C2 tRNA-Leu
  542. Escherichia coli 2-052-05_S3_C3 tRNA-Leu
  543. Escherichia coli 2-052-05_S4_C1 tRNA-Leu
  544. Escherichia coli 2-052-05_S4_C2 tRNA-Leu
  545. Escherichia coli 2-052-05_S4_C3 tRNA-Leu
  546. Escherichia coli 2-156-04_S1_C3 tRNA-Leu
  547. Escherichia coli 2-156-04_S3_C1 tRNA-Leu
  548. Escherichia coli 2-156-04_S3_C2 tRNA-Leu
  549. Escherichia coli 2-156-04_S3_C3 tRNA-Leu
  550. Escherichia coli 2-156-04_S4_C1 tRNA-Leu
  551. Escherichia coli 2-156-04_S4_C2 tRNA-Leu
  552. Escherichia coli 2-156-04_S4_C3 tRNA-Leu
  553. Escherichia coli 2-177-06_S1_C1 tRNA-Leu
  554. Escherichia coli 2-177-06_S1_C2 tRNA-Leu
  555. Escherichia coli 2-177-06_S1_C3 tRNA-Leu
  556. Escherichia coli 2-177-06_S3_C1 tRNA-Leu
  557. Escherichia coli 2-177-06_S3_C2 tRNA-Leu
  558. Escherichia coli 2-177-06_S3_C3 tRNA-Leu
  559. Escherichia coli 2-177-06_S4_C1 tRNA-Leu
  560. Escherichia coli 2-177-06_S4_C2 tRNA-Leu
  561. Escherichia coli 2-177-06_S4_C3 tRNA-Leu
  562. Escherichia coli 2-210-07_S1_C2 tRNA-Leu
  563. Escherichia coli 2-210-07_S1_C3 tRNA-Leu
  564. Escherichia coli 2-210-07_S3_C1 tRNA-Leu
  565. Escherichia coli 2-210-07_S3_C2 tRNA-Leu
  566. Escherichia coli 2-210-07_S3_C3 tRNA-Leu
  567. Escherichia coli 2-210-07_S4_C1 tRNA-Leu
  568. Escherichia coli 2-210-07_S4_C2 tRNA-Leu
  569. Escherichia coli 2-210-07_S4_C3 tRNA-Leu
  570. Escherichia coli 2-222-05_S1_C1 tRNA-Leu
  571. Escherichia coli 2-222-05_S1_C2 tRNA-Leu
  572. Escherichia coli 2-222-05_S1_C3 tRNA-Leu
  573. Escherichia coli 2-222-05_S3_C1 tRNA-Leu
  574. Escherichia coli 2-222-05_S3_C2 tRNA-Leu
  575. Escherichia coli 2-222-05_S3_C3 tRNA-Leu
  576. Escherichia coli 2-222-05_S4_C1 tRNA-Leu
  577. Escherichia coli 2-222-05_S4_C2 tRNA-Leu
  578. Escherichia coli 2-222-05_S4_C3 tRNA-Leu
  579. Escherichia coli 2-316-03_S1_C1 tRNA-Leu
  580. Escherichia coli 2-316-03_S1_C2 tRNA-Leu
  581. Escherichia coli 2-316-03_S3_C1 tRNA-Leu
  582. Escherichia coli 2-316-03_S3_C2 tRNA-Leu
  583. Escherichia coli 2-316-03_S3_C3 tRNA-Leu
  584. Escherichia coli 2-316-03_S4_C1 tRNA-Leu
  585. Escherichia coli 2-316-03_S4_C2 tRNA-Leu
  586. Escherichia coli 2-316-03_S4_C3 tRNA-Leu
  587. Escherichia coli 2362-75 tRNA-Leu
  588. Escherichia coli 2.3916 tRNA-Leu
  589. Escherichia coli 2.4168 tRNA-Leu
  590. Escherichia coli 2-427-07_S1_C1 tRNA-Leu
  591. Escherichia coli 2-427-07_S1_C2 tRNA-Leu
  592. Escherichia coli 2-427-07_S1_C3 tRNA-Leu
  593. Escherichia coli 2-427-07_S3_C1 tRNA-Leu
  594. Escherichia coli 2-427-07_S3_C3 tRNA-Leu
  595. Escherichia coli 2-427-07_S4_C1 tRNA-Leu
  596. Escherichia coli 2-427-07_S4_C2 tRNA-Leu
  597. Escherichia coli 2-427-07_S4_C3 tRNA-Leu
  598. Escherichia coli 2-460-02_S1_C1 tRNA-Leu
  599. Escherichia coli 2-460-02_S1_C2 tRNA-Leu
  600. Escherichia coli 2-460-02_S1_C3 tRNA-Leu
  601. Escherichia coli 2-460-02_S3_C1 tRNA-Leu
  602. Escherichia coli 2-460-02_S3_C2 tRNA-Leu
  603. Escherichia coli 2-460-02_S3_C3 tRNA-Leu
  604. Escherichia coli 2-460-02_S4_C1 tRNA-Leu
  605. Escherichia coli 2-460-02_S4_C2 tRNA-Leu
  606. Escherichia coli 2-460-02_S4_C3 tRNA-Leu
  607. Escherichia coli 2-474-04_S1_C1 tRNA-Leu
  608. Escherichia coli 2-474-04_S1_C2 tRNA-Leu
  609. Escherichia coli 2-474-04_S3_C1 tRNA-Leu
  610. Escherichia coli 2-474-04_S3_C2 tRNA-Leu
  611. Escherichia coli 2-474-04_S3_C3 tRNA-Leu
  612. Escherichia coli 2-474-04_S4_C1 tRNA-Leu
  613. Escherichia coli 2-474-04_S4_C2 tRNA-Leu
  614. Escherichia coli 2-474-04_S4_C3 tRNA-Leu
  615. Escherichia coli 2534-86 tRNA-Leu
  616. Escherichia coli 2719100 tRNA-Leu
  617. Escherichia coli 2720900 tRNA-Leu
  618. Escherichia coli 2722950 tRNA-Leu
  619. Escherichia coli 2726800 tRNA-Leu
  620. Escherichia coli 2726950 tRNA-Leu
  621. Escherichia coli 2729250 tRNA-Leu
  622. Escherichia coli 2730350 tRNA-Leu
  623. Escherichia coli 2730450 tRNA-Leu
  624. Escherichia coli 2731150 tRNA-Leu
  625. Escherichia coli 2733950 tRNA-Leu
  626. Escherichia coli 2735000 tRNA-Leu
  627. Escherichia coli 2741950 tRNA-Leu
  628. Escherichia coli 2747800 tRNA-Leu
  629. Escherichia coli 2749250 tRNA-Leu
  630. Escherichia coli 2756500 tRNA-Leu
  631. Escherichia coli 2762100 tRNA-Leu
  632. Escherichia coli 2770900 tRNA-Leu
  633. Escherichia coli 2780750 tRNA-Leu
  634. Escherichia coli 2785200 tRNA-Leu
  635. Escherichia coli 2788150 tRNA-Leu
  636. Escherichia coli 2845350 tRNA-Leu
  637. Escherichia coli 2845650 tRNA-Leu
  638. Escherichia coli 2846750 tRNA-Leu
  639. Escherichia coli 2848050 tRNA-Leu
  640. Escherichia coli 2850400 tRNA-Leu
  641. Escherichia coli 2850750 tRNA-Leu
  642. Escherichia coli 2851500 tRNA-Leu
  643. Escherichia coli 2853500 tRNA-Leu
  644. Escherichia coli 2854350 tRNA-Leu
  645. Escherichia coli 2860050 tRNA-Leu
  646. Escherichia coli 2860650 tRNA-Leu
  647. Escherichia coli 2861200 tRNA-Leu
  648. Escherichia coli 2862600 tRNA-Leu
  649. Escherichia coli 2864350 tRNA-Leu
  650. Escherichia coli 2865200 tRNA-Leu
  651. Escherichia coli 2866350 tRNA-Leu
  652. Escherichia coli 2866450 tRNA-Leu
  653. Escherichia coli 2866550 tRNA-Leu
  654. Escherichia coli 2866750 tRNA-Leu
  655. Escherichia coli 2867750 tRNA-Leu
  656. Escherichia coli 2871950 tRNA-Leu
  657. Escherichia coli 2872000 tRNA-Leu
  658. Escherichia coli 2872800 tRNA-Leu
  659. Escherichia coli 2875000 tRNA-Leu
  660. Escherichia coli 2875150 tRNA-Leu
  661. Escherichia coli 2886-75 tRNA-Leu
  662. Escherichia coli 3003 tRNA-Leu
  663. Escherichia coli 3006 tRNA-Leu
  664. Escherichia coli 3-020-07_S1_C1 tRNA-Leu
  665. Escherichia coli 3-020-07_S1_C2 tRNA-Leu
  666. Escherichia coli 3-020-07_S1_C3 tRNA-Leu
  667. Escherichia coli 3-020-07_S3_C1 tRNA-Leu
  668. Escherichia coli 3-020-07_S3_C2 tRNA-Leu
  669. Escherichia coli 3-020-07_S4_C1 tRNA-Leu
  670. Escherichia coli 3-020-07_S4_C2 tRNA-Leu
  671. Escherichia coli 3-020-07_S4_C3 tRNA-Leu
  672. Escherichia coli 3030-1 tRNA-Leu
  673. Escherichia coli 3-073-06_S1_C1 tRNA-Leu
  674. Escherichia coli 3-073-06_S1_C2 tRNA-Leu
  675. Escherichia coli 3-073-06_S3_C1 tRNA-Leu
  676. Escherichia coli 3-073-06_S3_C2 tRNA-Leu
  677. Escherichia coli 3-073-06_S4_C1 tRNA-Leu
  678. Escherichia coli 3-073-06_S4_C2 tRNA-Leu
  679. Escherichia coli 3-073-06_S4_C3 tRNA-Leu
  680. Escherichia coli 3-105-05_S1_C1 tRNA-Leu
  681. Escherichia coli 3-105-05_S1_C2 tRNA-Leu
  682. Escherichia coli 3-105-05_S1_C3 tRNA-Leu
  683. Escherichia coli 3-105-05_S3_C1 tRNA-Leu
  684. Escherichia coli 3-105-05_S3_C2 tRNA-Leu
  685. Escherichia coli 3-105-05_S3_C3 tRNA-Leu
  686. Escherichia coli 3-105-05_S4_C1 tRNA-Leu
  687. Escherichia coli 3-105-05_S4_C2 tRNA-Leu
  688. Escherichia coli 3-105-05_S4_C3 tRNA-Leu
  689. Escherichia coli 3.2303 tRNA-Leu
  690. Escherichia coli 3.2608 tRNA-Leu
  691. Escherichia coli 3-267-03_S1_C1 tRNA-Leu
  692. Escherichia coli 3-267-03_S1_C2 tRNA-Leu
  693. Escherichia coli 3-267-03_S1_C3 tRNA-Leu
  694. Escherichia coli 3-267-03_S3_C1 tRNA-Leu
  695. Escherichia coli 3-267-03_S3_C2 tRNA-Leu
  696. Escherichia coli 3-267-03_S4_C1 tRNA-Leu
  697. Escherichia coli 3-267-03_S4_C2 tRNA-Leu
  698. Escherichia coli 3-373-03_S1_C1 tRNA-Leu
  699. Escherichia coli 3-373-03_S1_C2 tRNA-Leu
  700. Escherichia coli 3-373-03_S1_C3 tRNA-Leu
  701. Escherichia coli 3-373-03_S3_C1 tRNA-Leu
  702. Escherichia coli 3-373-03_S3_C2 tRNA-Leu
  703. Escherichia coli 3-373-03_S3_C3 tRNA-Leu
  704. Escherichia coli 3-373-03_S4_C1 tRNA-Leu
  705. Escherichia coli 3-373-03_S4_C2 tRNA-Leu
  706. Escherichia coli 3-373-03_S4_C3 tRNA-Leu
  707. Escherichia coli 3.3884 tRNA-Leu
  708. Escherichia coli 3431 tRNA-Leu
  709. Escherichia coli 3-475-03_S1_C1 tRNA-Leu
  710. Escherichia coli 3-475-03_S1_C2 tRNA-Leu
  711. Escherichia coli 3-475-03_S3_C1 tRNA-Leu
  712. Escherichia coli 3-475-03_S3_C2 tRNA-Leu
  713. Escherichia coli 3-475-03_S4_C1 tRNA-Leu
  714. Escherichia coli 3-475-03_S4_C2 tRNA-Leu
  715. Escherichia coli 3.4870 tRNA-Leu
  716. Escherichia coli 3.4880 tRNA-Leu
  717. Escherichia coli 4.0522 tRNA-Leu
  718. Escherichia coli 4.0967 tRNA-Leu
  719. Escherichia coli 4_1_47FAA tRNA-Leu
  720. Escherichia coli 4-203-08_S1_C1 tRNA-Leu
  721. Escherichia coli 4-203-08_S1_C2 tRNA-Leu
  722. Escherichia coli 4-203-08_S1_C3 tRNA-Leu
  723. Escherichia coli 4-203-08_S3_C1 tRNA-Leu
  724. Escherichia coli 4-203-08_S3_C2 tRNA-Leu
  725. Escherichia coli 4-203-08_S3_C3 tRNA-Leu
  726. Escherichia coli 4-203-08_S4_C2 tRNA-Leu
  727. Escherichia coli 4-203-08_S4_C3 tRNA-Leu
  728. Escherichia coli 5.0588 tRNA-Leu
  729. Escherichia coli 5.0959 tRNA-Leu
  730. Escherichia coli 5-172-05_S1_C3 tRNA-Leu
  731. Escherichia coli 5-172-05_S3_C1 tRNA-Leu
  732. Escherichia coli 5-172-05_S3_C3 tRNA-Leu
  733. Escherichia coli 5-172-05_S4_C1 tRNA-Leu
  734. Escherichia coli 5-172-05_S4_C2 tRNA-Leu
  735. Escherichia coli 5-172-05_S4_C3 tRNA-Leu
  736. Escherichia coli 5.2239 tRNA-Leu
  737. Escherichia coli 5-366-08_S1_C1 tRNA-Leu
  738. Escherichia coli 5-366-08_S1_C3 tRNA-Leu
  739. Escherichia coli 5-366-08_S3_C1 tRNA-Leu
  740. Escherichia coli 5-366-08_S3_C2 tRNA-Leu
  741. Escherichia coli 5-366-08_S3_C3 tRNA-Leu
  742. Escherichia coli 5-366-08_S4_C1 tRNA-Leu
  743. Escherichia coli 5-366-08_S4_C2 tRNA-Leu
  744. Escherichia coli 536 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  745. Escherichia coli 541-15 tRNA-Leu
  746. Escherichia coli 541-1 tRNA-Leu
  747. Escherichia coli 5412 tRNA-Leu
  748. Escherichia coli 55989 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  749. Escherichia coli 576-1 tRNA-Leu
  750. Escherichia coli 5905 tRNA-Leu
  751. Escherichia coli 6.0172 tRNA-Leu
  752. Escherichia coli 6-175-07_S1_C1 tRNA-Leu
  753. Escherichia coli 6-175-07_S1_C2 tRNA-Leu
  754. Escherichia coli 6-175-07_S1_C3 tRNA-Leu
  755. Escherichia coli 6-175-07_S3_C1 tRNA-Leu
  756. Escherichia coli 6-175-07_S3_C2 tRNA-Leu
  757. Escherichia coli 6-175-07_S3_C3 tRNA-Leu
  758. Escherichia coli 6-175-07_S4_C1 tRNA-Leu
  759. Escherichia coli 6-175-07_S4_C2 tRNA-Leu
  760. Escherichia coli 6-175-07_S4_C3 tRNA-Leu
  761. Escherichia coli 6-319-05_S1_C1 tRNA-Leu
  762. Escherichia coli 6-319-05_S1_C2 tRNA-Leu
  763. Escherichia coli 6-319-05_S1_C3 tRNA-Leu
  764. Escherichia coli 6-319-05_S3_C1 tRNA-Leu
  765. Escherichia coli 6-319-05_S3_C2 tRNA-Leu
  766. Escherichia coli 6-319-05_S3_C3 tRNA-Leu
  767. Escherichia coli 6-319-05_S4_C2 tRNA-Leu
  768. Escherichia coli 6-319-05_S4_C3 tRNA-Leu
  769. Escherichia coli 6-537-08_S1_C1 tRNA-Leu
  770. Escherichia coli 6-537-08_S1_C2 tRNA-Leu
  771. Escherichia coli 6-537-08_S1_C3 tRNA-Leu
  772. Escherichia coli 6-537-08_S3_C1 tRNA-Leu
  773. Escherichia coli 6-537-08_S3_C2 tRNA-Leu
  774. Escherichia coli 6-537-08_S3_C3 tRNA-Leu
  775. Escherichia coli 6-537-08_S4_C1 tRNA-Leu
  776. Escherichia coli 6-537-08_S4_C2 tRNA-Leu
  777. Escherichia coli 7.1982 tRNA-Leu
  778. Escherichia coli 7-233-03_S1_C2 tRNA-Leu
  779. Escherichia coli 7-233-03_S1_C3 tRNA-Leu
  780. Escherichia coli 7-233-03_S3_C1 tRNA-Leu
  781. Escherichia coli 7-233-03_S3_C2 tRNA-Leu
  782. Escherichia coli 7-233-03_S3_C3 tRNA-Leu
  783. Escherichia coli 7-233-03_S4_C1 tRNA-Leu
  784. Escherichia coli 7-233-03_S4_C2 tRNA-Leu
  785. Escherichia coli 7-233-03_S4_C3 tRNA-Leu
  786. Escherichia coli 75 tRNA-Leu
  787. Escherichia coli 8.0416 tRNA-Leu
  788. Escherichia coli 8.0566 tRNA-Leu
  789. Escherichia coli 8.0569 tRNA-Leu
  790. Escherichia coli 8.0586 tRNA-Leu
  791. Escherichia coli 8.2524 tRNA-Leu
  792. Escherichia coli 83972 tRNA-Leu
  793. Escherichia coli 8-415-05_S1_C1 tRNA-Leu
  794. Escherichia coli 8-415-05_S1_C2 tRNA-Leu
  795. Escherichia coli 8-415-05_S3_C1 tRNA-Leu
  796. Escherichia coli 8-415-05_S3_C2 tRNA-Leu
  797. Escherichia coli 8-415-05_S3_C3 tRNA-Leu
  798. Escherichia coli 8-415-05_S4_C1 tRNA-Leu
  799. Escherichia coli 8-415-05_S4_C2 tRNA-Leu
  800. Escherichia coli 8-415-05_S4_C3 tRNA-Leu
  801. Escherichia coli 88.0221 tRNA-Leu
  802. Escherichia coli 88.1042 tRNA-Leu
  803. Escherichia coli 88.1467 tRNA-Leu
  804. Escherichia coli 89.0511 tRNA-Leu
  805. Escherichia coli 90.0039 tRNA-Leu
  806. Escherichia coli 90.0091 tRNA-Leu
  807. Escherichia coli 900105 (10e) tRNA-Leu
  808. Escherichia coli 9.0111 tRNA-Leu
  809. Escherichia coli 90.2281 tRNA-Leu
  810. Escherichia coli 907357 tRNA-Leu
  811. Escherichia coli 907391 tRNA-Leu
  812. Escherichia coli 907446 tRNA-Leu
  813. Escherichia coli 907672 tRNA-Leu
  814. Escherichia coli 907700 tRNA-Leu
  815. Escherichia coli 907701 tRNA-Leu
  816. Escherichia coli 907710 tRNA-Leu
  817. Escherichia coli 907713 tRNA-Leu
  818. Escherichia coli 907715 tRNA-Leu
  819. Escherichia coli 907779 tRNA-Leu
  820. Escherichia coli 907889 tRNA-Leu
  821. Escherichia coli 907892 tRNA-Leu
  822. Escherichia coli 908519 tRNA-Leu
  823. Escherichia coli 908521 tRNA-Leu
  824. Escherichia coli 908522 tRNA-Leu
  825. Escherichia coli 908524 tRNA-Leu
  826. Escherichia coli 908525 tRNA-Leu
  827. Escherichia coli 908541 tRNA-Leu
  828. Escherichia coli 908555 tRNA-Leu
  829. Escherichia coli 908573 tRNA-Leu
  830. Escherichia coli 908585 tRNA-Leu
  831. Escherichia coli 908616 tRNA-Leu
  832. Escherichia coli 908624 tRNA-Leu
  833. Escherichia coli 908632 tRNA-Leu
  834. Escherichia coli 908658 tRNA-Leu
  835. Escherichia coli 908675 tRNA-Leu
  836. Escherichia coli 908691 tRNA-Leu
  837. Escherichia coli 909945-2 tRNA-Leu
  838. Escherichia coli 910096-2 tRNA-Leu
  839. Escherichia coli 9.1649 tRNA-Leu
  840. Escherichia coli 93-001 tRNA-Leu
  841. Escherichia coli 93.0055 tRNA-Leu
  842. Escherichia coli 93.0056 tRNA-Leu
  843. Escherichia coli 93.0624 tRNA-Leu
  844. Escherichia coli 94.0618 tRNA-Leu
  845. Escherichia coli 95.0083 tRNA-Leu
  846. Escherichia coli 95.0183 tRNA-Leu
  847. Escherichia coli 95.0943 tRNA-Leu
  848. Escherichia coli 95.1288 tRNA-Leu
  849. Escherichia coli 95JB1 tRNA-Leu
  850. Escherichia coli 95NR1 tRNA-Leu
  851. Escherichia coli 96.0107 tRNA-Leu
  852. Escherichia coli 96.0109 tRNA-Leu
  853. Escherichia coli 96.0427 tRNA-Leu
  854. Escherichia coli 96.0428 tRNA-Leu
  855. Escherichia coli 96.0497 tRNA-Leu
  856. Escherichia coli 96.0932 tRNA-Leu
  857. Escherichia coli 96.0939 tRNA-Leu
  858. Escherichia coli 96.154 tRNA-Leu
  859. Escherichia coli 97.0003 tRNA-Leu
  860. Escherichia coli 97.0007 tRNA-Leu
  861. Escherichia coli 97.0010 tRNA-Leu
  862. Escherichia coli 97.0246 tRNA-Leu
  863. Escherichia coli 97.0259 tRNA-Leu
  864. Escherichia coli 97.0264 tRNA-Leu
  865. Escherichia coli 97.1742 tRNA-Leu
  866. Escherichia coli 99.0670 tRNA-Leu
  867. Escherichia coli 99.0672 tRNA-Leu
  868. Escherichia coli 99.0713 tRNA-Leu
  869. Escherichia coli 99.0741 tRNA-Leu
  870. Escherichia coli 99.0814 tRNA-Leu
  871. Escherichia coli 99.0815 tRNA-Leu
  872. Escherichia coli 99.0816 tRNA-Leu
  873. Escherichia coli 99.0839 tRNA-Leu
  874. Escherichia coli 99.0848 tRNA-Leu
  875. Escherichia coli 99.1753 tRNA-Leu
  876. Escherichia coli 99.1775 tRNA-Leu
  877. Escherichia coli 99.1781 tRNA-Leu
  878. Escherichia coli 99.1793 tRNA-Leu
  879. Escherichia coli 99.1805 tRNA-Leu
  880. Escherichia coli A25922R tRNA-Leu
  881. Escherichia coli A35218R tRNA-Leu
  882. Escherichia coli AA86 tRNA-Leu
  883. Escherichia coli ABU 83972 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  884. Escherichia coli ACN001 tRNA-Leu
  885. Escherichia coli AD30 tRNA-Leu
  886. Escherichia coli AI27 tRNA-Leu
  887. Escherichia coli APEC IMT5155 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  888. Escherichia coli APEC O18 tRNA-Leu
  889. Escherichia coli APEC O1 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  890. Escherichia coli APEC O2-211 tRNA-Leu
  891. Escherichia coli APEC O2 tRNA-Leu
  892. Escherichia coli APEC O78 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  893. Escherichia coli ARS4.2123 tRNA-Leu
  894. Escherichia coli ATCC 25922 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  895. Escherichia coli ATCC 35150 tRNA-Leu
  896. Escherichia coli ATCC 700728 tRNA-Leu
  897. Escherichia coli ATCC 8739 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  898. Escherichia coli ATCC BAA-2192 tRNA-Leu
  899. Escherichia coli ATCC BAA-2193 tRNA-Leu
  900. Escherichia coli ATCC BAA-2196 tRNA-Leu
  901. Escherichia coli ATCC BAA-2209 tRNA-Leu
  902. Escherichia coli ATCC BAA-2215 tRNA-Leu
  903. Escherichia coli ATCC BAA-2219 tRNA-Leu
  904. Escherichia coli B088 tRNA-Leu
  905. Escherichia coli B093 tRNA-Leu
  906. Escherichia coli B102 tRNA-Leu
  907. Escherichia coli B103 tRNA-Leu
  908. Escherichia coli B104 tRNA-Leu
  909. Escherichia coli B106 tRNA-Leu
  910. Escherichia coli B107 tRNA-Leu
  911. Escherichia coli B108 tRNA-Leu
  912. Escherichia coli B109 tRNA-Leu
  913. Escherichia coli B112 tRNA-Leu
  914. Escherichia coli B113 tRNA-Leu
  915. Escherichia coli B114 tRNA-Leu
  916. Escherichia coli B15 tRNA-Leu
  917. Escherichia coli B175 tRNA-Leu
  918. Escherichia coli B17 tRNA-Leu
  919. Escherichia coli B185 tRNA-Leu
  920. Escherichia coli B26-1 tRNA-Leu
  921. Escherichia coli B26-2 tRNA-Leu
  922. Escherichia coli B28-1 tRNA-Leu
  923. Escherichia coli B28-2 tRNA-Leu
  924. Escherichia coli B29-1 tRNA-Leu
  925. Escherichia coli B29-2 tRNA-Leu
  926. Escherichia coli B354 tRNA-Leu
  927. Escherichia coli B36-1 tRNA-Leu
  928. Escherichia coli B36-2 tRNA-Leu
  929. Escherichia coli B367 tRNA-Leu
  930. Escherichia coli B40-1 tRNA-Leu
  931. Escherichia coli B40-2 tRNA-Leu
  932. Escherichia coli B41 tRNA-Leu
  933. Escherichia coli B5-2 tRNA-Leu
  934. Escherichia coli B574 tRNA-Leu
  935. Escherichia coli B671 tRNA-Leu
  936. Escherichia coli B7-1 tRNA-Leu
  937. Escherichia coli B7-2 tRNA-Leu
  938. Escherichia coli B799 tRNA-Leu
  939. Escherichia coli B7A tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  940. Escherichia coli B83 tRNA-Leu
  941. Escherichia coli B84 tRNA-Leu
  942. Escherichia coli B85 tRNA-Leu
  943. Escherichia coli B86 tRNA-Leu
  944. Escherichia coli B89 tRNA-Leu
  945. Escherichia coli B90 tRNA-Leu
  946. Escherichia coli B921 tRNA-Leu
  947. Escherichia coli B93 tRNA-Leu
  948. Escherichia coli B94 tRNA-Leu
  949. Escherichia coli B95 tRNA-Leu
  950. Escherichia coli BCE001_MS16 tRNA-Leu
  951. Escherichia coli BCE002_MS12 tRNA-Leu
  952. Escherichia coli BCE006_MS-23 tRNA-Leu
  953. Escherichia coli BCE007_MS-11 tRNA-Leu
  954. Escherichia coli BCE008_MS-01 tRNA-Leu
  955. Escherichia coli BCE008_MS-13 tRNA-Leu
  956. Escherichia coli BCE011_MS-01 tRNA-Leu
  957. Escherichia coli BCE019_MS-13 tRNA-Leu
  958. Escherichia coli BCE030_MS-09 tRNA-Leu
  959. Escherichia coli BCE032_MS-12 tRNA-Leu
  960. Escherichia coli BCE034_MS-14 tRNA-Leu
  961. Escherichia coli Bd5610_99 tRNA-Leu
  962. Escherichia coli BIDMC 15 tRNA-Leu
  963. Escherichia coli BIDMC 17A tRNA-Leu
  964. Escherichia coli BIDMC 17B tRNA-Leu
  965. Escherichia coli BIDMC 19A tRNA-Leu
  966. Escherichia coli BIDMC 19B tRNA-Leu
  967. Escherichia coli BIDMC 19C tRNA-Leu
  968. Escherichia coli BIDMC 20A tRNA-Leu
  969. Escherichia coli BIDMC 20B tRNA-Leu
  970. Escherichia coli BIDMC 2B tRNA-Leu
  971. Escherichia coli BIDMC 37 tRNA-Leu
  972. Escherichia coli BIDMC 38 tRNA-Leu
  973. Escherichia coli BIDMC 39 tRNA-Leu
  974. Escherichia coli BIDMC 3 tRNA-Leu
  975. Escherichia coli BIDMC 43a tRNA-Leu
  976. Escherichia coli BIDMC 43b tRNA-Leu
  977. Escherichia coli BIDMC 49a tRNA-Leu
  978. Escherichia coli BIDMC 49b tRNA-Leu
  979. Escherichia coli BIDMC 58 tRNA-Leu
  980. Escherichia coli BIDMC 59 tRNA-Leu
  981. Escherichia coli BIDMC 62 tRNA-Leu
  982. Escherichia coli BIDMC 63 tRNA-Leu
  983. Escherichia coli BIDMC 64 tRNA-Leu
  984. Escherichia coli BIDMC 65 tRNA-Leu
  985. Escherichia coli BIDMC 6 tRNA-Leu
  986. Escherichia coli BIDMC 70 tRNA-Leu
  987. Escherichia coli BIDMC 71 tRNA-Leu
  988. Escherichia coli BIDMC 72 tRNA-Leu
  989. Escherichia coli BIDMC 73 tRNA-Leu
  990. Escherichia coli BIDMC 74 tRNA-Leu
  991. Escherichia coli BIDMC 75 tRNA-Leu
  992. Escherichia coli BIDMC 76 tRNA-Leu
  993. Escherichia coli BIDMC 77 tRNA-Leu
  994. Escherichia coli BIDMC 78 tRNA-Leu
  995. Escherichia coli BIDMC 79 tRNA-Leu
  996. Escherichia coli BIDMC 82 tRNA-Leu
  997. Escherichia coli BIDMC 83 tRNA-Leu
  998. Escherichia coli BIDMC 9 tRNA-Leu
  999. Escherichia coli BL21(DE3) tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  1000. Escherichia coli 'BL21-Gold(DE3)pLysS AG' tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  1001. Escherichia coli BL21 tRNA-Leu
  1002. Escherichia coli B str. REL606 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  1003. Escherichia coli B tRNA-Leu
  1004. Escherichia coli BW2952 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  1005. Escherichia coli BWH 24 tRNA-Leu
  1006. Escherichia coli BWH 32 tRNA-Leu
  1007. Escherichia coli BWH 34 tRNA-Leu
  1008. Escherichia coli BWH 40 tRNA-Leu
  1009. Escherichia coli C-34666 tRNA-Leu
  1010. Escherichia coli C691-71 (14b) tRNA-Leu
  1011. Escherichia coli CAG:4 transfer RNA-Leu(CAA)
  1012. Escherichia coli CB7326 tRNA-Leu
  1013. Escherichia coli CFT073 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  1014. Escherichia coli CHS 68 tRNA-Leu
  1015. Escherichia coli CHS 69 tRNA-Leu
  1016. Escherichia coli CHS 77 tRNA-Leu
  1017. Escherichia coli C tRNA-Leu
  1018. Escherichia coli CUMT8 tRNA-Leu
  1019. Escherichia coli D6-113.11 transfer RNA-Leu
  1020. Escherichia coli D6-117.29 transfer RNA-Leu
  1021. Escherichia coli D9 tRNA-Leu
  1022. Escherichia coli DEC10A tRNA-Leu
  1023. Escherichia coli DEC10B tRNA-Leu
  1024. Escherichia coli DEC10C tRNA-Leu
  1025. Escherichia coli DEC10D tRNA-Leu
  1026. Escherichia coli DEC10E tRNA-Leu
  1027. Escherichia coli DEC10F tRNA-Leu
  1028. Escherichia coli DEC11A tRNA-Leu
  1029. Escherichia coli DEC11B tRNA-Leu
  1030. Escherichia coli DEC11C tRNA-Leu
  1031. Escherichia coli DEC11D tRNA-Leu
  1032. Escherichia coli DEC11E tRNA-Leu
  1033. Escherichia coli DEC12A tRNA-Leu
  1034. Escherichia coli DEC12B tRNA-Leu
  1035. Escherichia coli DEC12C tRNA-Leu
  1036. Escherichia coli DEC12D tRNA-Leu
  1037. Escherichia coli DEC12E tRNA-Leu
  1038. Escherichia coli DEC13A tRNA-Leu
  1039. Escherichia coli DEC13B tRNA-Leu
  1040. Escherichia coli DEC13C tRNA-Leu
  1041. Escherichia coli DEC13D tRNA-Leu
  1042. Escherichia coli DEC13E tRNA-Leu
  1043. Escherichia coli DEC14A tRNA-Leu
  1044. Escherichia coli DEC14B tRNA-Leu
  1045. Escherichia coli DEC14C tRNA-Leu
  1046. Escherichia coli DEC14D tRNA-Leu
  1047. Escherichia coli DEC15B tRNA-Leu
  1048. Escherichia coli DEC15C tRNA-Leu
  1049. Escherichia coli DEC15D tRNA-Leu
  1050. Escherichia coli DEC15E tRNA-Leu
  1051. Escherichia coli DEC1A tRNA-Leu
  1052. Escherichia coli DEC1B tRNA-Leu
  1053. Escherichia coli DEC1C tRNA-Leu
  1054. Escherichia coli DEC1D tRNA-Leu
  1055. Escherichia coli DEC1E tRNA-Leu
  1056. Escherichia coli DEC2A tRNA-Leu
  1057. Escherichia coli DEC2B tRNA-Leu
  1058. Escherichia coli DEC2C tRNA-Leu
  1059. Escherichia coli DEC2D tRNA-Leu
  1060. Escherichia coli DEC2E tRNA-Leu
  1061. Escherichia coli DEC3A tRNA-Leu
  1062. Escherichia coli DEC3B tRNA-Leu
  1063. Escherichia coli DEC3C tRNA-Leu
  1064. Escherichia coli DEC3D tRNA-Leu
  1065. Escherichia coli DEC3E tRNA-Leu
  1066. Escherichia coli DEC3F tRNA-Leu
  1067. Escherichia coli DEC4A tRNA-Leu
  1068. Escherichia coli DEC4B tRNA-Leu
  1069. Escherichia coli DEC4C tRNA-Leu
  1070. Escherichia coli DEC4D tRNA-Leu
  1071. Escherichia coli DEC4E tRNA-Leu
  1072. Escherichia coli DEC4F tRNA-Leu
  1073. Escherichia coli DEC5A tRNA-Leu
  1074. Escherichia coli DEC5B tRNA-Leu
  1075. Escherichia coli DEC5C tRNA-Leu
  1076. Escherichia coli DEC5D tRNA-Leu
  1077. Escherichia coli DEC5E tRNA-Leu
  1078. Escherichia coli DEC6A tRNA-Leu
  1079. Escherichia coli DEC6B tRNA-Leu
  1080. Escherichia coli DEC6C tRNA-Leu
  1081. Escherichia coli DEC6D tRNA-Leu
  1082. Escherichia coli DEC6E tRNA-Leu
  1083. Escherichia coli DEC7A tRNA-Leu
  1084. Escherichia coli DEC7B tRNA-Leu
  1085. Escherichia coli DEC7C tRNA-Leu
  1086. Escherichia coli DEC7D tRNA-Leu
  1087. Escherichia coli DEC7E tRNA-Leu
  1088. Escherichia coli DEC8A tRNA-Leu
  1089. Escherichia coli DEC8B tRNA-Leu
  1090. Escherichia coli DEC8C tRNA-Leu
  1091. Escherichia coli DEC8D tRNA-Leu
  1092. Escherichia coli DEC8E tRNA-Leu
  1093. Escherichia coli DEC9A tRNA-Leu
  1094. Escherichia coli DEC9B tRNA-Leu
  1095. Escherichia coli DEC9C tRNA-Leu
  1096. Escherichia coli DEC9D tRNA-Leu
  1097. Escherichia coli DEC9E tRNA-Leu
  1098. Escherichia coli DH1 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  1099. Escherichia coli DSM 30083 = JCM 1649 = ATCC 11775 tRNA-Leu
  1100. Escherichia coli E1002 tRNA-Leu
  1101. Escherichia coli E101 tRNA-Leu
  1102. Escherichia coli E1114 tRNA-Leu
  1103. Escherichia coli E1118 tRNA-Leu
  1104. Escherichia coli E1140 tRNA-Leu
  1105. Escherichia coli E1167 tRNA-Leu
  1106. Escherichia coli E128010 tRNA-Leu
  1107. Escherichia coli E1520 tRNA-Leu
  1108. Escherichia coli E1728 tRNA-Leu
  1109. Escherichia coli E267 tRNA-Leu
  1110. Escherichia coli E482 tRNA-Leu
  1111. Escherichia coli E560 tRNA-Leu
  1112. Escherichia coli E704 tRNA-Leu
  1113. Escherichia coli EC096/10 tRNA-Leu
  1114. Escherichia coli EC1734 tRNA-Leu
  1115. Escherichia coli EC1735 tRNA-Leu
  1116. Escherichia coli EC1736 tRNA-Leu
  1117. Escherichia coli EC1737 tRNA-Leu
  1118. Escherichia coli EC1738 tRNA-Leu
  1119. Escherichia coli EC1845 tRNA-Leu
  1120. Escherichia coli EC1846 tRNA-Leu
  1121. Escherichia coli EC1847 tRNA-Leu
  1122. Escherichia coli EC1848 tRNA-Leu
  1123. Escherichia coli EC1849 tRNA-Leu
  1124. Escherichia coli EC1850 tRNA-Leu
  1125. Escherichia coli EC1856 tRNA-Leu
  1126. Escherichia coli EC1862 tRNA-Leu
  1127. Escherichia coli EC1863 tRNA-Leu
  1128. Escherichia coli EC1864 tRNA-Leu
  1129. Escherichia coli EC1865 tRNA-Leu
  1130. Escherichia coli EC1866 tRNA-Leu
  1131. Escherichia coli EC1868 tRNA-Leu
  1132. Escherichia coli EC1869 tRNA-Leu
  1133. Escherichia coli EC1870 tRNA-Leu
  1134. Escherichia coli EC4013 tRNA-Leu
  1135. Escherichia coli EC4196 tRNA-Leu
  1136. Escherichia coli EC4203 tRNA-Leu
  1137. Escherichia coli EC4402 tRNA-Leu
  1138. Escherichia coli EC4421 tRNA-Leu
  1139. Escherichia coli EC4422 tRNA-Leu
  1140. Escherichia coli EC4436 tRNA-Leu
  1141. Escherichia coli EC4437 tRNA-Leu
  1142. Escherichia coli EC4439 tRNA-Leu
  1143. Escherichia coli EC4448 tRNA-Leu
  1144. Escherichia coli EC96038 tRNA-Leu
  1145. Escherichia coli ECA-0157 tRNA-Leu
  1146. Escherichia coli ECA-727 tRNA-Leu
  1147. Escherichia coli ECC-1470 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  1148. Escherichia coli ECC-Z tRNA-Leu
  1149. Escherichia coli ED1a tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  1150. Escherichia coli Envira 10/1 tRNA-Leu
  1151. Escherichia coli Envira 8/11 tRNA-Leu
  1152. Escherichia coli EPECa12 tRNA-Leu
  1153. Escherichia coli EPECa14 tRNA-Leu
  1154. Escherichia coli EPEC C342-62 tRNA-Leu
  1155. Escherichia coli ER2796 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  1156. Escherichia coli ETEC H10407 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  1157. Escherichia coli FAP1 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  1158. Escherichia coli FDA504 tRNA-Leu
  1159. Escherichia coli FDA505 tRNA-Leu
  1160. Escherichia coli FDA506 tRNA-Leu
  1161. Escherichia coli FDA507 tRNA-Leu
  1162. Escherichia coli FDA517 tRNA-Leu
  1163. Escherichia coli FRIK1985 tRNA-Leu
  1164. Escherichia coli FRIK1990 tRNA-Leu
  1165. Escherichia coli FRIK1996 tRNA-Leu
  1166. Escherichia coli FRIK1997 tRNA-Leu
  1167. Escherichia coli FRIK1999 tRNA-Leu
  1168. Escherichia coli FRIK2001 tRNA-Leu
  1169. Escherichia coli FRIK523 tRNA-Leu
  1170. Escherichia coli FRIK920 tRNA-Leu
  1171. Escherichia coli FVEC1302 tRNA-Leu
  1172. Escherichia coli FVEC1412 tRNA-Leu
  1173. Escherichia coli FVEC1465 tRNA-Leu
  1174. Escherichia coli G3/10 tRNA-Leu
  1175. Escherichia coli G58-1 tRNA-Leu
  1176. Escherichia coli H001 tRNA-Leu
  1177. Escherichia coli H120 tRNA-Leu
  1178. Escherichia coli H19 tRNA-Leu
  1179. Escherichia coli H20 tRNA-Leu
  1180. Escherichia coli H223 tRNA-Leu
  1181. Escherichia coli H252 tRNA-Leu
  1182. Escherichia coli H263 tRNA-Leu
  1183. Escherichia coli H296 tRNA-Leu
  1184. Escherichia coli H299 tRNA-Leu
  1185. Escherichia coli H305 tRNA-Leu
  1186. Escherichia coli H378 tRNA-Leu
  1187. Escherichia coli H383 tRNA-Leu
  1188. Escherichia coli H386 tRNA-Leu
  1189. Escherichia coli H397 tRNA-Leu
  1190. Escherichia coli H413 tRNA-Leu
  1191. Escherichia coli H420 tRNA-Leu
  1192. Escherichia coli H454 tRNA-Leu
  1193. Escherichia coli H461 tRNA-Leu
  1194. Escherichia coli H489 tRNA-Leu
  1195. Escherichia coli H494 tRNA-Leu
  1196. Escherichia coli H588 tRNA-Leu
  1197. Escherichia coli H591 tRNA-Leu
  1198. Escherichia coli H605 tRNA-Leu
  1199. Escherichia coli H617 tRNA-Leu
  1200. Escherichia coli H730 tRNA-Leu
  1201. Escherichia coli H736 tRNA-Leu
  1202. Escherichia coli H8 tRNA-Leu
  1203. Escherichia coli HM605 tRNA-Leu
  1204. Escherichia coli HS tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  1205. Escherichia coli HT115 tRNA-Leu
  1206. Escherichia coli HVH 100 (4-2850729) (4-2850729) tRNA-Leu
  1207. Escherichia coli HVH 101 (4-6859844) tRNA-Leu
  1208. Escherichia coli HVH 102 (4-6906788) tRNA-Leu
  1209. Escherichia coli HVH 103 (4-5904188) tRNA-Leu
  1210. Escherichia coli HVH 104 (4-6977960) (4-6977960) tRNA-Leu
  1211. Escherichia coli HVH 10 (4-6832164) tRNA-Leu
  1212. Escherichia coli HVH 106 (4-6881831) tRNA-Leu
  1213. Escherichia coli HVH 107 (4-5860571) (4-5860571) tRNA-Leu
  1214. Escherichia coli HVH 108 (4-6924867) (4-6924867) tRNA-Leu
  1215. Escherichia coli HVH 109 (4-6977162) tRNA-Leu
  1216. Escherichia coli HVH 110 (4-6978754) tRNA-Leu
  1217. Escherichia coli HVH 111 (4-7039018) tRNA-Leu
  1218. Escherichia coli HVH 112 (4-5987253) tRNA-Leu
  1219. Escherichia coli HVH 113 (4-7535473) (4-7535473) tRNA-Leu
  1220. Escherichia coli HVH 114 (4-7037740) tRNA-Leu
  1221. Escherichia coli HVH 115 (4-4465989) tRNA-Leu
  1222. Escherichia coli HVH 115 (4-4465997) tRNA-Leu
  1223. Escherichia coli HVH 116 (4-6879942) tRNA-Leu
  1224. Escherichia coli HVH 117 (4-6857191) tRNA-Leu
  1225. Escherichia coli HVH 118 (4-7345399) tRNA-Leu
  1226. Escherichia coli HVH 119 (4-6879578) tRNA-Leu
  1227. Escherichia coli HVH 120 (4-6978681) tRNA-Leu
  1228. Escherichia coli HVH 121 (4-6877826) (4-6877826) tRNA-Leu
  1229. Escherichia coli HVH 122 (4-6851606) tRNA-Leu
  1230. Escherichia coli HVH 12 (4-7653042) tRNA-Leu
  1231. Escherichia coli HVH 125 (4-2634716) tRNA-Leu
  1232. Escherichia coli HVH 126 (4-6034225) tRNA-Leu
  1233. Escherichia coli HVH 127 (4-7303629) tRNA-Leu
  1234. Escherichia coli HVH 128 (4-7030436) tRNA-Leu
  1235. Escherichia coli HVH 130 (4-7036876) tRNA-Leu
  1236. Escherichia coli HVH 132 (4-6876862) (4-6876862) tRNA-Leu
  1237. Escherichia coli HVH 133 (4-4466519) (4-4466519) tRNA-Leu
  1238. Escherichia coli HVH 134 (4-6073441) tRNA-Leu
  1239. Escherichia coli HVH 13 (4-7634056) tRNA-Leu
  1240. Escherichia coli HVH 135 (4-4449320) (4-4449320) tRNA-Leu
  1241. Escherichia coli HVH 136 (4-5970458) tRNA-Leu
  1242. Escherichia coli HVH 137 (4-2124971) (4-2124971) tRNA-Leu
  1243. Escherichia coli HVH 138 (4-6066704) tRNA-Leu
  1244. Escherichia coli HVH 139 (4-3192644) tRNA-Leu
  1245. Escherichia coli HVH 140 (4-5894387) tRNA-Leu
  1246. Escherichia coli HVH 141 (4-5995973) (4-5995973) tRNA-Leu
  1247. Escherichia coli HVH 142 (4-5627451) tRNA-Leu
  1248. Escherichia coli HVH 143 (4-5674999) tRNA-Leu
  1249. Escherichia coli HVH 144 (4-4451937) tRNA-Leu
  1250. Escherichia coli HVH 145 (4-5672112) tRNA-Leu
  1251. Escherichia coli HVH 146 (4-3189767) tRNA-Leu
  1252. Escherichia coli HVH 1 (4-6876161) tRNA-Leu
  1253. Escherichia coli HVH 147 (4-5893887) tRNA-Leu
  1254. Escherichia coli HVH 148 (4-3192490) (4-3192490) tRNA-Leu
  1255. Escherichia coli HVH 149 (4-4451880) tRNA-Leu
  1256. Escherichia coli HVH 150 (4-3258106) tRNA-Leu
  1257. Escherichia coli HVH 151 (4-5755573) tRNA-Leu
  1258. Escherichia coli HVH 152 (4-3447545) tRNA-Leu
  1259. Escherichia coli HVH 153 (3-9344314) tRNA-Leu
  1260. Escherichia coli HVH 155 (4-4509048) tRNA-Leu
  1261. Escherichia coli HVH 156 (4-3206505) tRNA-Leu
  1262. Escherichia coli HVH 157 (4-3406229) tRNA-Leu
  1263. Escherichia coli HVH 158 (4-3224287) tRNA-Leu
  1264. Escherichia coli HVH 159 (4-5818141) tRNA-Leu
  1265. Escherichia coli HVH 160 (4-5695937) tRNA-Leu
  1266. Escherichia coli HVH 161 (4-3119890) tRNA-Leu
  1267. Escherichia coli HVH 162 (4-5627982) tRNA-Leu
  1268. Escherichia coli HVH 163 (4-4697553) tRNA-Leu
  1269. Escherichia coli HVH 164 (4-5953081) tRNA-Leu
  1270. Escherichia coli HVH 16 (4-7649002) (4-7649002) tRNA-Leu
  1271. Escherichia coli HVH 167 (4-6073565) (4-6073565) tRNA-Leu
  1272. Escherichia coli HVH 169 (4-1075578) tRNA-Leu
  1273. Escherichia coli HVH 170 (4-3026949) tRNA-Leu
  1274. Escherichia coli HVH 171 (4-3191958) tRNA-Leu
  1275. Escherichia coli HVH 172 (4-3248542) tRNA-Leu
  1276. Escherichia coli HVH 173 (3-9175482) tRNA-Leu
  1277. Escherichia coli HVH 17 (4-7473087) tRNA-Leu
  1278. Escherichia coli HVH 175 (4-3405184) (4-3405184) tRNA-Leu
  1279. Escherichia coli HVH 176 (4-3428664) tRNA-Leu
  1280. Escherichia coli HVH 177 (4-2876612) tRNA-Leu
  1281. Escherichia coli HVH 178 (4-3189163) (4-3189163) tRNA-Leu
  1282. Escherichia coli HVH 180 (4-3051617) (4-3051617) tRNA-Leu
  1283. Escherichia coli HVH 182 (4-0985554) tRNA-Leu
  1284. Escherichia coli HVH 183 (4-3205932) (4-3205932) tRNA-Leu
  1285. Escherichia coli HVH 184 (4-3343286) tRNA-Leu
  1286. Escherichia coli HVH 18 (4-8589585) (4-8589585) tRNA-Leu
  1287. Escherichia coli HVH 185 (4-2876639) tRNA-Leu
  1288. Escherichia coli HVH 186 (4-3405044) tRNA-Leu
  1289. Escherichia coli HVH 187 (4-4471660) tRNA-Leu
  1290. Escherichia coli HVH 188 (4-2356988) (4-2356988) tRNA-Leu
  1291. Escherichia coli HVH 189 (4-3220125) tRNA-Leu
  1292. Escherichia coli HVH 190 (4-3255514) tRNA-Leu
  1293. Escherichia coli HVH 191 (3-9341900) tRNA-Leu
  1294. Escherichia coli HVH 192 (4-3054470) tRNA-Leu
  1295. Escherichia coli HVH 193 (4-3331423) tRNA-Leu
  1296. Escherichia coli HVH 194 (4-2356805) tRNA-Leu
  1297. Escherichia coli HVH 19 (4-7154984) tRNA-Leu
  1298. Escherichia coli HVH 195 (3-7155360) tRNA-Leu
  1299. Escherichia coli HVH 196 (4-4530470) tRNA-Leu
  1300. Escherichia coli HVH 197 (4-4466217) tRNA-Leu
  1301. Escherichia coli HVH 198 (4-3206106) tRNA-Leu
  1302. Escherichia coli HVH 199 (4-5670322) tRNA-Leu
  1303. Escherichia coli HVH 200 (4-4449924) tRNA-Leu
  1304. Escherichia coli HVH 201 (4-4459431) tRNA-Leu
  1305. Escherichia coli HVH 202 (4-3163997) tRNA-Leu
  1306. Escherichia coli HVH 203 (4-3126218) (4-3126218) tRNA-Leu
  1307. Escherichia coli HVH 204 (4-3112802) tRNA-Leu
  1308. Escherichia coli HVH 20 (4-5865042) (4-5865042) tRNA-Leu
  1309. Escherichia coli HVH 205 (4-3094677) tRNA-Leu
  1310. Escherichia coli HVH 206 (4-3128229) tRNA-Leu
  1311. Escherichia coli HVH 207 (4-3113221) tRNA-Leu
  1312. Escherichia coli HVH 208 (4-3112292) tRNA-Leu
  1313. Escherichia coli HVH 209 (4-3062651) (4-3062651) tRNA-Leu
  1314. Escherichia coli HVH 210 (4-3042480) tRNA-Leu
  1315. Escherichia coli HVH 211 (4-3041891) tRNA-Leu
  1316. Escherichia coli HVH 212 (3-9305343) tRNA-Leu
  1317. Escherichia coli HVH 213 (4-3042928) tRNA-Leu
  1318. Escherichia coli HVH 214 (4-3062198) tRNA-Leu
  1319. Escherichia coli HVH 21 (4-4517873) tRNA-Leu
  1320. Escherichia coli HVH 215 (4-3008371) tRNA-Leu
  1321. Escherichia coli HVH 216 (4-3042952) tRNA-Leu
  1322. Escherichia coli HVH 217 (4-1022806) tRNA-Leu
  1323. Escherichia coli HVH 218 (4-4500903) tRNA-Leu
  1324. Escherichia coli HVH 220 (4-5876842) tRNA-Leu
  1325. Escherichia coli HVH 221 (4-3136817) (4-3136817) tRNA-Leu
  1326. Escherichia coli HVH 222 (4-2977443) tRNA-Leu
  1327. Escherichia coli HVH 223 (4-2976528) tRNA-Leu
  1328. Escherichia coli HVH 22 (4-2258986) tRNA-Leu
  1329. Escherichia coli HVH 225 (4-1273116) tRNA-Leu
  1330. Escherichia coli HVH 227 (4-2277670) tRNA-Leu
  1331. Escherichia coli HVH 228 (4-7787030) (4-7787030) tRNA-Leu
  1332. Escherichia coli HVH 23 (4-6066488) tRNA-Leu
  1333. Escherichia coli HVH 24 (4-5985145) tRNA-Leu
  1334. Escherichia coli HVH 2 (4-6943160) tRNA-Leu
  1335. Escherichia coli HVH 25 (4-5851939) tRNA-Leu
  1336. Escherichia coli HVH 26 (4-5703913) (4-5703913) tRNA-Leu
  1337. Escherichia coli HVH 27 (4-7449267) tRNA-Leu
  1338. Escherichia coli HVH 28 (4-0907367) tRNA-Leu
  1339. Escherichia coli HVH 29 (4-3418073) tRNA-Leu
  1340. Escherichia coli HVH 30 (4-2661829) tRNA-Leu
  1341. Escherichia coli HVH 31 (4-2602156) tRNA-Leu
  1342. Escherichia coli HVH 32 (4-3773988) tRNA-Leu
  1343. Escherichia coli HVH 33 (4-2174936) tRNA-Leu
  1344. Escherichia coli HVH 3 (4-7276001) tRNA-Leu
  1345. Escherichia coli HVH 35 (4-2962667) tRNA-Leu
  1346. Escherichia coli HVH 36 (4-5675286) tRNA-Leu
  1347. Escherichia coli HVH 37 (4-2773848) tRNA-Leu
  1348. Escherichia coli HVH 38 (4-2774682) tRNA-Leu
  1349. Escherichia coli HVH 39 (4-2679949) (4-2679949) tRNA-Leu
  1350. Escherichia coli HVH 40 (4-1219782) tRNA-Leu
  1351. Escherichia coli HVH 41 (4-2677849) tRNA-Leu
  1352. Escherichia coli HVH 42 (4-2100061) tRNA-Leu
  1353. Escherichia coli HVH 43 (4-2173468) tRNA-Leu
  1354. Escherichia coli HVH 44 (4-2298570) tRNA-Leu
  1355. Escherichia coli HVH 4 (4-7276109) tRNA-Leu
  1356. Escherichia coli HVH 45 (4-3129918) tRNA-Leu
  1357. Escherichia coli HVH 46 (4-2758776) tRNA-Leu
  1358. Escherichia coli HVH 48 (4-2658593) tRNA-Leu
  1359. Escherichia coli HVH 50 (4-2593475) (4-2593475) tRNA-Leu
  1360. Escherichia coli HVH 51 (4-2172526) (4-2172526) tRNA-Leu
  1361. Escherichia coli HVH 53 (4-0631051) tRNA-Leu
  1362. Escherichia coli HVH 54 (4-2723514) tRNA-Leu
  1363. Escherichia coli HVH 5 (4-7148410) tRNA-Leu
  1364. Escherichia coli HVH 56 (4-2153033) (4-2153033) tRNA-Leu
  1365. Escherichia coli HVH 58 (4-2839709) tRNA-Leu
  1366. Escherichia coli HVH 59 (4-1119338) tRNA-Leu
  1367. Escherichia coli HVH 61 (4-2736020) tRNA-Leu
  1368. Escherichia coli HVH 63 (4-2542528) (4-2542528) tRNA-Leu
  1369. Escherichia coli HVH 6 (3-8296502) tRNA-Leu
  1370. Escherichia coli HVH 65 (4-2262045) tRNA-Leu
  1371. Escherichia coli HVH 68 (4-0888028) (4-0888028) tRNA-Leu
  1372. Escherichia coli HVH 69 (4-2837072) tRNA-Leu
  1373. Escherichia coli HVH 70 (4-2963531) tRNA-Leu
  1374. Escherichia coli HVH 73 (4-2393174) tRNA-Leu
  1375. Escherichia coli HVH 74 (4-1034782) tRNA-Leu
  1376. Escherichia coli HVH 7 (4-7315031) (4-7315031) tRNA-Leu
  1377. Escherichia coli HVH 76 (4-2538717) tRNA-Leu
  1378. Escherichia coli HVH 77 (4-2605759) (4-2605759) tRNA-Leu
  1379. Escherichia coli HVH 78 (4-2735946) tRNA-Leu
  1380. Escherichia coli HVH 79 (4-2512823) tRNA-Leu
  1381. Escherichia coli HVH 80 (4-2428830) tRNA-Leu
  1382. Escherichia coli HVH 82 (4-2209276) tRNA-Leu
  1383. Escherichia coli HVH 83 (4-2051087) tRNA-Leu
  1384. Escherichia coli HVH 84 (4-1021478) tRNA-Leu
  1385. Escherichia coli HVH 85 (4-0792144) tRNA-Leu
  1386. Escherichia coli HVH 86 (4-7026218) tRNA-Leu
  1387. Escherichia coli HVH 87 (4-5977630) tRNA-Leu
  1388. Escherichia coli HVH 88 (4-5854636) tRNA-Leu
  1389. Escherichia coli HVH 89 (4-5885604) tRNA-Leu
  1390. Escherichia coli HVH 90 (4-3191362) (4-3191362) tRNA-Leu
  1391. Escherichia coli HVH 91 (4-4638751) tRNA-Leu
  1392. Escherichia coli HVH 92 (4-5930790) tRNA-Leu
  1393. Escherichia coli HVH 93 (4-5851025) tRNA-Leu
  1394. Escherichia coli HVH 9 (4-6942539) tRNA-Leu
  1395. Escherichia coli HVH 95 (4-6074464) tRNA-Leu
  1396. Escherichia coli HVH 96 (4-5934869) tRNA-Leu
  1397. Escherichia coli HVH 98 (4-5799287) (4-5799287) tRNA-Leu
  1398. Escherichia coli IAI1 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  1399. Escherichia coli IAI39 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  1400. Escherichia coli IHE3034 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  1401. Escherichia coli J53 tRNA-Leu
  1402. Escherichia coli J96 tRNA-Leu
  1403. Escherichia coli JB1-95 tRNA-Leu
  1404. Escherichia coli JJ1886 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  1405. Escherichia coli JJ1887 tRNA-Leu
  1406. Escherichia coli Jurua 18/11 tRNA-Leu
  1407. Escherichia coli Jurua 20/10 tRNA-Leu
  1408. Escherichia coli K02 tRNA-Leu
  1409. Escherichia coli K-12 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  1410. Escherichia coli K71 tRNA-Leu
  1411. Escherichia coli KD1 tRNA-Leu
  1412. Escherichia coli KD2 tRNA-Leu
  1413. Escherichia coli KLY tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  1414. Escherichia coli KO11FL tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  1415. Escherichia coli KOEGE 10 (25a) (25a) tRNA-Leu
  1416. Escherichia coli KOEGE 118 (317a) tRNA-Leu
  1417. Escherichia coli KOEGE 131 (358a) (358a) tRNA-Leu
  1418. Escherichia coli KOEGE 30 (63a) tRNA-Leu
  1419. Escherichia coli KOEGE 32 (66a) tRNA-Leu
  1420. Escherichia coli KOEGE 33 (68a) tRNA-Leu
  1421. Escherichia coli KOEGE 3 (4a) tRNA-Leu
  1422. Escherichia coli KOEGE 40 (102a) tRNA-Leu
  1423. Escherichia coli KOEGE 43 (105a) tRNA-Leu
  1424. Escherichia coli KOEGE 44 (106a) tRNA-Leu
  1425. Escherichia coli KOEGE 56 (169a) tRNA-Leu
  1426. Escherichia coli KOEGE 58 (171a) tRNA-Leu
  1427. Escherichia coli KOEGE 61 (174a) tRNA-Leu
  1428. Escherichia coli KOEGE 62 (175a) tRNA-Leu
  1429. Escherichia coli KOEGE 68 (182a) (182a) tRNA-Leu
  1430. Escherichia coli KOEGE 70 (185a) tRNA-Leu
  1431. Escherichia coli KOEGE 71 (186a) tRNA-Leu
  1432. Escherichia coli KOEGE 7 (16a) tRNA-Leu
  1433. Escherichia coli KOEGE 73 (195a) tRNA-Leu
  1434. Escherichia coli KOEGE 77 (202a) (202a) tRNA-Leu
  1435. Escherichia coli KTE100 tRNA-Leu
  1436. Escherichia coli KTE101 tRNA-Leu
  1437. Escherichia coli KTE102 tRNA-Leu
  1438. Escherichia coli KTE103 tRNA-Leu
  1439. Escherichia coli KTE104 tRNA-Leu
  1440. Escherichia coli KTE105 tRNA-Leu
  1441. Escherichia coli KTE106 tRNA-Leu
  1442. Escherichia coli KTE107 tRNA-Leu
  1443. Escherichia coli KTE108 tRNA-Leu
  1444. Escherichia coli KTE109 tRNA-Leu
  1445. Escherichia coli KTE10 tRNA-Leu
  1446. Escherichia coli KTE111 tRNA-Leu
  1447. Escherichia coli KTE112 tRNA-Leu
  1448. Escherichia coli KTE113 tRNA-Leu
  1449. Escherichia coli KTE115 tRNA-Leu
  1450. Escherichia coli KTE116 tRNA-Leu
  1451. Escherichia coli KTE117 tRNA-Leu
  1452. Escherichia coli KTE118 tRNA-Leu
  1453. Escherichia coli KTE119 tRNA-Leu
  1454. Escherichia coli KTE120 tRNA-Leu
  1455. Escherichia coli KTE121 tRNA-Leu
  1456. Escherichia coli KTE122 tRNA-Leu
  1457. Escherichia coli KTE123 tRNA-Leu
  1458. Escherichia coli KTE124 tRNA-Leu
  1459. Escherichia coli KTE125 tRNA-Leu
  1460. Escherichia coli KTE126 tRNA-Leu
  1461. Escherichia coli KTE127 tRNA-Leu
  1462. Escherichia coli KTE128 tRNA-Leu
  1463. Escherichia coli KTE129 tRNA-Leu
  1464. Escherichia coli KTE12 tRNA-Leu
  1465. Escherichia coli KTE130 tRNA-Leu
  1466. Escherichia coli KTE131 tRNA-Leu
  1467. Escherichia coli KTE132 tRNA-Leu
  1468. Escherichia coli KTE133 tRNA-Leu
  1469. Escherichia coli KTE134 tRNA-Leu
  1470. Escherichia coli KTE135 tRNA-Leu
  1471. Escherichia coli KTE136 tRNA-Leu
  1472. Escherichia coli KTE137 tRNA-Leu
  1473. Escherichia coli KTE138 tRNA-Leu
  1474. Escherichia coli KTE139 tRNA-Leu
  1475. Escherichia coli KTE13 tRNA-Leu
  1476. Escherichia coli KTE140 tRNA-Leu
  1477. Escherichia coli KTE141 tRNA-Leu
  1478. Escherichia coli KTE142 tRNA-Leu
  1479. Escherichia coli KTE143 tRNA-Leu
  1480. Escherichia coli KTE144 tRNA-Leu
  1481. Escherichia coli KTE145 tRNA-Leu
  1482. Escherichia coli KTE146 tRNA-Leu
  1483. Escherichia coli KTE147 tRNA-Leu
  1484. Escherichia coli KTE148 tRNA-Leu
  1485. Escherichia coli KTE14 tRNA-Leu
  1486. Escherichia coli KTE150 tRNA-Leu
  1487. Escherichia coli KTE153 tRNA-Leu
  1488. Escherichia coli KTE154 tRNA-Leu
  1489. Escherichia coli KTE155 tRNA-Leu
  1490. Escherichia coli KTE156 tRNA-Leu
  1491. Escherichia coli KTE157 tRNA-Leu
  1492. Escherichia coli KTE158 tRNA-Leu
  1493. Escherichia coli KTE15 tRNA-Leu
  1494. Escherichia coli KTE160 tRNA-Leu
  1495. Escherichia coli KTE161 tRNA-Leu
  1496. Escherichia coli KTE162 tRNA-Leu
  1497. Escherichia coli KTE163 tRNA-Leu
  1498. Escherichia coli KTE165 tRNA-Leu
  1499. Escherichia coli KTE166 tRNA-Leu
  1500. Escherichia coli KTE167 tRNA-Leu
  1501. Escherichia coli KTE168 tRNA-Leu
  1502. Escherichia coli KTE169 tRNA-Leu
  1503. Escherichia coli KTE16 tRNA-Leu
  1504. Escherichia coli KTE170 tRNA-Leu
  1505. Escherichia coli KTE171 tRNA-Leu
  1506. Escherichia coli KTE173 tRNA-Leu
  1507. Escherichia coli KTE174 tRNA-Leu
  1508. Escherichia coli KTE175 tRNA-Leu
  1509. Escherichia coli KTE176 tRNA-Leu
  1510. Escherichia coli KTE177 tRNA-Leu
  1511. Escherichia coli KTE178 tRNA-Leu
  1512. Escherichia coli KTE179 tRNA-Leu
  1513. Escherichia coli KTE17 tRNA-Leu
  1514. Escherichia coli KTE180 tRNA-Leu
  1515. Escherichia coli KTE181 tRNA-Leu
  1516. Escherichia coli KTE182 tRNA-Leu
  1517. Escherichia coli KTE183 tRNA-Leu
  1518. Escherichia coli KTE184 tRNA-Leu
  1519. Escherichia coli KTE185 tRNA-Leu
  1520. Escherichia coli KTE186 tRNA-Leu
  1521. Escherichia coli KTE187 tRNA-Leu
  1522. Escherichia coli KTE188 tRNA-Leu
  1523. Escherichia coli KTE189 tRNA-Leu
  1524. Escherichia coli KTE18 tRNA-Leu
  1525. Escherichia coli KTE190 tRNA-Leu
  1526. Escherichia coli KTE191 tRNA-Leu
  1527. Escherichia coli KTE192 tRNA-Leu
  1528. Escherichia coli KTE193 tRNA-Leu
  1529. Escherichia coli KTE194 tRNA-Leu
  1530. Escherichia coli KTE195 tRNA-Leu
  1531. Escherichia coli KTE196 tRNA-Leu
  1532. Escherichia coli KTE197 tRNA-Leu
  1533. Escherichia coli KTE198 tRNA-Leu
  1534. Escherichia coli KTE199 tRNA-Leu
  1535. Escherichia coli KTE19 tRNA-Leu
  1536. Escherichia coli KTE1 tRNA-Leu
  1537. Escherichia coli KTE200 tRNA-Leu
  1538. Escherichia coli KTE201 tRNA-Leu
  1539. Escherichia coli KTE202 tRNA-Leu
  1540. Escherichia coli KTE203 tRNA-Leu
  1541. Escherichia coli KTE204 tRNA-Leu
  1542. Escherichia coli KTE205 tRNA-Leu
  1543. Escherichia coli KTE206 tRNA-Leu
  1544. Escherichia coli KTE207 tRNA-Leu
  1545. Escherichia coli KTE208 tRNA-Leu
  1546. Escherichia coli KTE209 tRNA-Leu
  1547. Escherichia coli KTE20 tRNA-Leu
  1548. Escherichia coli KTE210 tRNA-Leu
  1549. Escherichia coli KTE211 tRNA-Leu
  1550. Escherichia coli KTE212 tRNA-Leu
  1551. Escherichia coli KTE213 tRNA-Leu
  1552. Escherichia coli KTE214 tRNA-Leu
  1553. Escherichia coli KTE215 tRNA-Leu
  1554. Escherichia coli KTE216 tRNA-Leu
  1555. Escherichia coli KTE217 tRNA-Leu
  1556. Escherichia coli KTE218 tRNA-Leu
  1557. Escherichia coli KTE219 tRNA-Leu
  1558. Escherichia coli KTE21 tRNA-Leu
  1559. Escherichia coli KTE220 tRNA-Leu
  1560. Escherichia coli KTE221 tRNA-Leu
  1561. Escherichia coli KTE222 tRNA-Leu
  1562. Escherichia coli KTE223 tRNA-Leu
  1563. Escherichia coli KTE224 tRNA-Leu
  1564. Escherichia coli KTE225 tRNA-Leu
  1565. Escherichia coli KTE226 tRNA-Leu
  1566. Escherichia coli KTE227 tRNA-Leu
  1567. Escherichia coli KTE228 tRNA-Leu
  1568. Escherichia coli KTE229 tRNA-Leu
  1569. Escherichia coli KTE22 tRNA-Leu
  1570. Escherichia coli KTE230 tRNA-Leu
  1571. Escherichia coli KTE231 tRNA-Leu
  1572. Escherichia coli KTE232 tRNA-Leu
  1573. Escherichia coli KTE233 tRNA-Leu
  1574. Escherichia coli KTE234 tRNA-Leu
  1575. Escherichia coli KTE235 tRNA-Leu
  1576. Escherichia coli KTE236 tRNA-Leu
  1577. Escherichia coli KTE237 tRNA-Leu
  1578. Escherichia coli KTE23 tRNA-Leu
  1579. Escherichia coli KTE240 tRNA-Leu
  1580. Escherichia coli KTE24 tRNA-Leu
  1581. Escherichia coli KTE25 tRNA-Leu
  1582. Escherichia coli KTE26 tRNA-Leu
  1583. Escherichia coli KTE27 tRNA-Leu
  1584. Escherichia coli KTE28 tRNA-Leu
  1585. Escherichia coli KTE29 tRNA-Leu
  1586. Escherichia coli KTE2 tRNA-Leu
  1587. Escherichia coli KTE33 tRNA-Leu
  1588. Escherichia coli KTE34 tRNA-Leu
  1589. Escherichia coli KTE35 tRNA-Leu
  1590. Escherichia coli KTE36 tRNA-Leu
  1591. Escherichia coli KTE37 tRNA-Leu
  1592. Escherichia coli KTE38 tRNA-Leu
  1593. Escherichia coli KTE39 tRNA-Leu
  1594. Escherichia coli KTE3 tRNA-Leu
  1595. Escherichia coli KTE40 tRNA-Leu
  1596. Escherichia coli KTE41 tRNA-Leu
  1597. Escherichia coli KTE42 tRNA-Leu
  1598. Escherichia coli KTE43 tRNA-Leu
  1599. Escherichia coli KTE44 tRNA-Leu
  1600. Escherichia coli KTE45 tRNA-Leu
  1601. Escherichia coli KTE46 tRNA-Leu
  1602. Escherichia coli KTE47 tRNA-Leu
  1603. Escherichia coli KTE48 tRNA-Leu
  1604. Escherichia coli KTE49 tRNA-Leu
  1605. Escherichia coli KTE4 tRNA-Leu
  1606. Escherichia coli KTE50 tRNA-Leu
  1607. Escherichia coli KTE51 tRNA-Leu
  1608. Escherichia coli KTE53 tRNA-Leu
  1609. Escherichia coli KTE54 tRNA-Leu
  1610. Escherichia coli KTE55 tRNA-Leu
  1611. Escherichia coli KTE56 tRNA-Leu
  1612. Escherichia coli KTE57 tRNA-Leu
  1613. Escherichia coli KTE58 tRNA-Leu
  1614. Escherichia coli KTE59 tRNA-Leu
  1615. Escherichia coli KTE5 tRNA-Leu
  1616. Escherichia coli KTE60 tRNA-Leu
  1617. Escherichia coli KTE61 tRNA-Leu
  1618. Escherichia coli KTE62 tRNA-Leu
  1619. Escherichia coli KTE63 tRNA-Leu
  1620. Escherichia coli KTE64 tRNA-Leu
  1621. Escherichia coli KTE65 tRNA-Leu
  1622. Escherichia coli KTE66 tRNA-Leu
  1623. Escherichia coli KTE67 tRNA-Leu
  1624. Escherichia coli KTE68 tRNA-Leu
  1625. Escherichia coli KTE69 tRNA-Leu
  1626. Escherichia coli KTE6 tRNA-Leu
  1627. Escherichia coli KTE70 tRNA-Leu
  1628. Escherichia coli KTE71 tRNA-Leu
  1629. Escherichia coli KTE72 tRNA-Leu
  1630. Escherichia coli KTE73 tRNA-Leu
  1631. Escherichia coli KTE74 tRNA-Leu
  1632. Escherichia coli KTE75 tRNA-Leu
  1633. Escherichia coli KTE76 tRNA-Leu
  1634. Escherichia coli KTE77 tRNA-Leu
  1635. Escherichia coli KTE78 tRNA-Leu
  1636. Escherichia coli KTE79 tRNA-Leu
  1637. Escherichia coli KTE7 tRNA-Leu
  1638. Escherichia coli KTE80 tRNA-Leu
  1639. Escherichia coli KTE81 tRNA-Leu
  1640. Escherichia coli KTE82 tRNA-Leu
  1641. Escherichia coli KTE83 tRNA-Leu
  1642. Escherichia coli KTE84 tRNA-Leu
  1643. Escherichia coli KTE85 tRNA-Leu
  1644. Escherichia coli KTE86 tRNA-Leu
  1645. Escherichia coli KTE87 tRNA-Leu
  1646. Escherichia coli KTE88 tRNA-Leu
  1647. Escherichia coli KTE89 tRNA-Leu
  1648. Escherichia coli KTE8 tRNA-Leu
  1649. Escherichia coli KTE90 tRNA-Leu
  1650. Escherichia coli KTE91 tRNA-Leu
  1651. Escherichia coli KTE93 tRNA-Leu
  1652. Escherichia coli KTE94 tRNA-Leu
  1653. Escherichia coli KTE95 tRNA-Leu
  1654. Escherichia coli KTE97 tRNA-Leu
  1655. Escherichia coli KTE98 tRNA-Leu
  1656. Escherichia coli KTE99 tRNA-Leu
  1657. Escherichia coli KTE9 tRNA-Leu
  1658. Escherichia coli LAU-EC10 tRNA-Leu
  1659. Escherichia coli LAU-EC6 tRNA-Leu
  1660. Escherichia coli LAU-EC7 tRNA-Leu
  1661. Escherichia coli LAU-EC8 tRNA-Leu
  1662. Escherichia coli LAU-EC9 tRNA-Leu
  1663. Escherichia coli LF82 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  1664. Escherichia coli LT-68 tRNA-Leu
  1665. Escherichia coli LY180 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  1666. Escherichia coli M056 tRNA-Leu
  1667. Escherichia coli M114 tRNA-Leu
  1668. Escherichia coli M12 tRNA-Leu
  1669. Escherichia coli M4 tRNA-Leu
  1670. Escherichia coli M605 tRNA-Leu
  1671. Escherichia coli M718 tRNA-Leu
  1672. Escherichia coli M863 tRNA-Leu
  1673. Escherichia coli M8 tRNA-Leu
  1674. Escherichia coli M919 tRNA-Leu
  1675. Escherichia coli MA6 tRNA-Leu
  1676. Escherichia coli MGH 57 tRNA-Leu
  1677. Escherichia coli MGH 58 tRNA-Leu
  1678. Escherichia coli MP020940.1 tRNA-Leu
  1679. Escherichia coli MP020980.1 tRNA-Leu
  1680. Escherichia coli MP020980.2 tRNA-Leu
  1681. Escherichia coli MP021017.10 tRNA-Leu
  1682. Escherichia coli MP021017.11 tRNA-Leu
  1683. Escherichia coli MP021017.12 tRNA-Leu
  1684. Escherichia coli MP021017.1 tRNA-Leu
  1685. Escherichia coli MP021017.2 tRNA-Leu
  1686. Escherichia coli MP021017.3 tRNA-Leu
  1687. Escherichia coli MP021017.4 tRNA-Leu
  1688. Escherichia coli MP021017.5 tRNA-Leu
  1689. Escherichia coli MP021017.6 tRNA-Leu
  1690. Escherichia coli MP021017.9 tRNA-Leu
  1691. Escherichia coli MP021552.11 tRNA-Leu
  1692. Escherichia coli MP021552.12 tRNA-Leu
  1693. Escherichia coli MP021552.7 tRNA-Leu
  1694. Escherichia coli MP021552.8 tRNA-Leu
  1695. Escherichia coli MP021561.2 tRNA-Leu
  1696. Escherichia coli MP021561.3 tRNA-Leu
  1697. Escherichia coli MP021566.1 tRNA-Leu
  1698. Escherichia coli MP1 tRNA-Leu
  1699. Escherichia coli MRSN 10204 tRNA-Leu
  1700. Escherichia coli MS 107-1 tRNA-Leu
  1701. Escherichia coli MS 110-3 tRNA-Leu
  1702. Escherichia coli MS 115-1 tRNA-Leu
  1703. Escherichia coli MS 116-1 tRNA-Leu
  1704. Escherichia coli MS 117-3 tRNA-Leu
  1705. Escherichia coli MS 119-7 tRNA-Leu
  1706. Escherichia coli MS 124-1 tRNA-Leu
  1707. Escherichia coli MS 145-7 tRNA-Leu
  1708. Escherichia coli MS 146-1 tRNA-Leu
  1709. Escherichia coli MS 153-1 tRNA-Leu
  1710. Escherichia coli MS 16-3 tRNA-Leu
  1711. Escherichia coli MS 175-1 tRNA-Leu
  1712. Escherichia coli MS 182-1 tRNA-Leu
  1713. Escherichia coli MS 185-1 tRNA-Leu
  1714. Escherichia coli MS 187-1 tRNA-Leu
  1715. Escherichia coli MS 196-1 tRNA-Leu
  1716. Escherichia coli MS 198-1 tRNA-Leu
  1717. Escherichia coli MS 200-1 tRNA-Leu
  1718. Escherichia coli MS 21-1 tRNA-Leu
  1719. Escherichia coli MS 45-1 tRNA-Leu
  1720. Escherichia coli MS 57-2 tRNA-Leu
  1721. Escherichia coli MS 60-1 tRNA-Leu
  1722. Escherichia coli MS 69-1 tRNA-Leu
  1723. Escherichia coli MS 78-1 tRNA-Leu
  1724. Escherichia coli MS 79-10 tRNA-Leu
  1725. Escherichia coli MS 84-1 tRNA-Leu
  1726. Escherichia coli MS 85-1 tRNA-Leu
  1727. Escherichia coli N1 tRNA-Leu
  1728. Escherichia coli N36254PS tRNA-Leu
  1729. Escherichia coli N36410PS tRNA-Leu
  1730. Escherichia coli N37058PS tRNA-Leu
  1731. Escherichia coli N37122PS tRNA-Leu
  1732. Escherichia coli N37139PS tRNA-Leu
  1733. Escherichia coli N40513 tRNA-Leu
  1734. Escherichia coli N40607 tRNA-Leu
  1735. Escherichia coli NA114 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  1736. Escherichia coli NB8 tRNA-Leu
  1737. Escherichia coli NC101 tRNA-Leu
  1738. Escherichia coli NCCP15648 tRNA-Leu
  1739. Escherichia coli NCTC 50110 tRNA-Leu
  1740. Escherichia coli NE037 tRNA-Leu
  1741. Escherichia coli NE098 tRNA-Leu
  1742. Escherichia coli NE1487 tRNA-Leu
  1743. Escherichia coli Nissle 1917 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  1744. Escherichia coli NU14 tRNA-Leu
  1745. Escherichia coli O08 tRNA-Leu
  1746. Escherichia coli O100:H12 tRNA-Leu
  1747. Escherichia coli O100:H21 tRNA-Leu
  1748. Escherichia coli O100 tRNA-Leu
  1749. Escherichia coli O101 tRNA-Leu
  1750. Escherichia coli O102:H6 tRNA-Leu
  1751. Escherichia coli O102 tRNA-Leu
  1752. Escherichia coli O103:H11 str. 04-3023 tRNA-Leu
  1753. Escherichia coli O103:H11 str. 2010C-3214 tRNA-Leu
  1754. Escherichia coli O103:H25 str. 2010C-4529 tRNA-Leu
  1755. Escherichia coli O103:H25 str. CVM9340 tRNA-Leu
  1756. Escherichia coli O103:H2 str. 12009 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  1757. Escherichia coli O103:H2 str. 2009C-3279 tRNA-Leu
  1758. Escherichia coli O103:H2 str. 2010C-4433 tRNA-Leu
  1759. Escherichia coli O103:H2 str. 2011C-3750 tRNA-Leu
  1760. Escherichia coli O103:H2 str. CVM9450 tRNA-Leu
  1761. Escherichia coli O103:H2 tRNA-Leu
  1762. Escherichia coli O103 str. RM8385 tRNA-Leu
  1763. Escherichia coli O103 tRNA-Leu
  1764. Escherichia coli O104:H21 str. 94-3025 tRNA-Leu
  1765. Escherichia coli O104:H21 str. CFSAN002236 tRNA-Leu
  1766. Escherichia coli O104:H21 str. CFSAN002237 tRNA-Leu
  1767. Escherichia coli O104:H4 str. 01-09591 tRNA-Leu
  1768. Escherichia coli O104:H4 str. 04-8351 tRNA-Leu
  1769. Escherichia coli O104:H4 str. 09-7901 tRNA-Leu
  1770. Escherichia coli O104:H4 str. 11-02030 tRNA-Leu
  1771. Escherichia coli O104:H4 str. 11-02033-1 tRNA-Leu
  1772. Escherichia coli O104:H4 str. 11-02092 tRNA-Leu
  1773. Escherichia coli O104:H4 str. 11-02093 tRNA-Leu
  1774. Escherichia coli O104:H4 str. 11-02281 tRNA-Leu
  1775. Escherichia coli O104:H4 str. 11-02318 tRNA-Leu
  1776. Escherichia coli O104:H4 str. 11-02913 tRNA-Leu
  1777. Escherichia coli O104:H4 str. 11-03439 tRNA-Leu
  1778. Escherichia coli O104:H4 str. 11-03943 tRNA-Leu
  1779. Escherichia coli O104:H4 str. 11-04080 tRNA-Leu
  1780. Escherichia coli O104:H4 str. 11-3677 tRNA-Leu
  1781. Escherichia coli O104:H4 str. 11-4404 tRNA-Leu
  1782. Escherichia coli O104:H4 str. 11-4522 tRNA-Leu
  1783. Escherichia coli O104:H4 str. 11-4623 tRNA-Leu
  1784. Escherichia coli O104:H4 str. 11-4632 C1 tRNA-Leu
  1785. Escherichia coli O104:H4 str. 11-4632 C2 tRNA-Leu
  1786. Escherichia coli O104:H4 str. 11-4632 C3 tRNA-Leu
  1787. Escherichia coli O104:H4 str. 11-4632 C4 tRNA-Leu
  1788. Escherichia coli O104:H4 str. 11-4632 C5 tRNA-Leu
  1789. Escherichia coli O104:H4 str. 2009EL-2050 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  1790. Escherichia coli O104:H4 str. 2009EL-2071 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  1791. Escherichia coli O104:H4 str. 2011C-3493 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  1792. Escherichia coli O104:H4 str. 2011EL-1675A tRNA-Leu
  1793. Escherichia coli O104:H4 str. C227-11 tRNA-Leu
  1794. Escherichia coli O104:H4 str. C236-11 tRNA-Leu
  1795. Escherichia coli O104:H4 str. E112/10 tRNA-Leu
  1796. Escherichia coli O104:H4 str. E92/11 tRNA-Leu
  1797. Escherichia coli O104:H4 str. Ec11-4984 tRNA-Leu
  1798. Escherichia coli O104:H4 str. Ec11-4986 tRNA-Leu
  1799. Escherichia coli O104:H4 str. Ec11-4987 tRNA-Leu
  1800. Escherichia coli O104:H4 str. Ec11-4988 tRNA-Leu
  1801. Escherichia coli O104:H4 str. Ec11-5603 tRNA-Leu
  1802. Escherichia coli O104:H4 str. Ec11-5604 tRNA-Leu
  1803. Escherichia coli O104:H4 str. Ec11-6006 tRNA-Leu
  1804. Escherichia coli O104:H4 str. Ec11-9450 tRNA-Leu
  1805. Escherichia coli O104:H4 str. Ec11-9941 tRNA-Leu
  1806. Escherichia coli O104:H4 str. Ec11-9990 tRNA-Leu
  1807. Escherichia coli O104:H4 str. Ec12-0465 tRNA-Leu
  1808. Escherichia coli O104:H4 str. Ec12-0466 tRNA-Leu
  1809. Escherichia coli O104:H4 str. LB226692 tRNA-Leu
  1810. Escherichia coli O104:H4 tRNA-Leu
  1811. Escherichia coli O104 tRNA-Leu
  1812. Escherichia coli O105 tRNA-Leu
  1813. Escherichia coli O106 tRNA-Leu
  1814. Escherichia coli O107 tRNA-Leu
  1815. Escherichia coli O108:H9 tRNA-Leu
  1816. Escherichia coli O109 tRNA-Leu
  1817. Escherichia coli O10:H32 tRNA-Leu
  1818. Escherichia coli O10:K5(L):H4 str. ATCC 23506 tRNA-Leu-CAA
  1819. Escherichia coli O110 tRNA-Leu
  1820. Escherichia coli O111:H11 str. CFSAN001630 tRNA-Leu
  1821. Escherichia coli O111:H11 str. CVM9455 tRNA-Leu
  1822. Escherichia coli O111:H11 str. CVM9534 tRNA-Leu
  1823. Escherichia coli O111:H11 str. CVM9545 tRNA-Leu
  1824. Escherichia coli O111:H11 str. CVM9553 tRNA-Leu
  1825. Escherichia coli O111:H8 str. 2009C-4126 tRNA-Leu
  1826. Escherichia coli O111:H8 str. 2009EL-2169 tRNA-Leu
  1827. Escherichia coli O111:H8 str. 2011C-3453 tRNA-Leu
  1828. Escherichia coli O111:H8 str. CFSAN001632 tRNA-Leu
  1829. Escherichia coli O111:H8 str. CVM9570 tRNA-Leu
  1830. Escherichia coli O111:H8 str. CVM9574 tRNA-Leu
  1831. Escherichia coli O111:H8 str. CVM9602 tRNA-Leu
  1832. Escherichia coli O111:H8 str. CVM9634 tRNA-Leu
  1833. Escherichia coli O111:H8 str. F6627 tRNA-Leu
  1834. Escherichia coli O111:H8 tRNA-Leu
  1835. Escherichia coli O111:H- str. 11128 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  1836. Escherichia coli O111:H- tRNA-Leu
  1837. Escherichia coli O111:NM str. 01-3076 tRNA-Leu
  1838. Escherichia coli O111:NM str. 03-3484 tRNA-Leu
  1839. Escherichia coli O111:NM str. 04-3211 tRNA-Leu
  1840. Escherichia coli O111:NM str. 08-4487 tRNA-Leu
  1841. Escherichia coli O111:NM str. 2009C-4006 tRNA-Leu
  1842. Escherichia coli O111:NM str. 2009C-4052 tRNA-Leu
  1843. Escherichia coli O111:NM str. 2010C-3053 tRNA-Leu
  1844. Escherichia coli O111:NM str. 2010C-3977 tRNA-Leu
  1845. Escherichia coli O111:NM str. 2010C-4086 tRNA-Leu
  1846. Escherichia coli O111:NM str. 2010C-4221 tRNA-Leu
  1847. Escherichia coli O111:NM str. 2010C-4592 tRNA-Leu
  1848. Escherichia coli O111:NM str. 2010C-4622 tRNA-Leu
  1849. Escherichia coli O111:NM str. 2010C-4715 tRNA-Leu
  1850. Escherichia coli O111:NM str. 2010C-4735 tRNA-Leu
  1851. Escherichia coli O111:NM str. 2010C-4746 tRNA-Leu
  1852. Escherichia coli O111:NM str. 2010C-4799 tRNA-Leu
  1853. Escherichia coli O111:NM str. 2010C-4818 tRNA-Leu
  1854. Escherichia coli O111:NM str. 2011C-3170 tRNA-Leu
  1855. Escherichia coli O111:NM str. 2011C-3362 tRNA-Leu
  1856. Escherichia coli O111:NM str. 2011C-3573 tRNA-Leu
  1857. Escherichia coli O111:NM str. 2011C-3632 tRNA-Leu
  1858. Escherichia coli O111:NM str. 2011C-3679 tRNA-Leu
  1859. Escherichia coli O111:NM str. K6722 tRNA-Leu
  1860. Escherichia coli O111:NM str. K6723 tRNA-Leu
  1861. Escherichia coli O111:NM str. K6728 tRNA-Leu
  1862. Escherichia coli O111:NM str. K6890 tRNA-Leu
  1863. Escherichia coli O111:NM str. K6895 tRNA-Leu
  1864. Escherichia coli O111:NM str. K6897 tRNA-Leu
  1865. Escherichia coli O111:NM str. K6898 tRNA-Leu
  1866. Escherichia coli O111:NM str. K6904 tRNA-Leu
  1867. Escherichia coli O111:NM str. K6908 tRNA-Leu
  1868. Escherichia coli O111:NM str. K6915 tRNA-Leu
  1869. Escherichia coli O111:NM tRNA-Leu
  1870. Escherichia coli O111 str. RM9322 tRNA-Leu
  1871. Escherichia coli O111 tRNA-Leu
  1872. Escherichia coli O112ab:H8 tRNA-Leu
  1873. Escherichia coli O113:H21 str. 07-4224 tRNA-Leu
  1874. Escherichia coli O113:H21 tRNA-Leu
  1875. Escherichia coli O113:H36 tRNA-Leu
  1876. Escherichia coli O113 tRNA-Leu
  1877. Escherichia coli O117 tRNA-Leu
  1878. Escherichia coli O118:H16 str. 06-3256 tRNA-Leu
  1879. Escherichia coli O118:H16 str. 06-3612 tRNA-Leu
  1880. Escherichia coli O118:H16 str. 07-4255 tRNA-Leu
  1881. Escherichia coli O118:H16 str. 08-3651 tRNA-Leu
  1882. Escherichia coli O118:H16 str. 2009C-4446 tRNA-Leu
  1883. Escherichia coli O119:H4 str. 03-3458 tRNA-Leu
  1884. Escherichia coli O119 tRNA-Leu
  1885. Escherichia coli O11:H15 tRNA-Leu
  1886. Escherichia coli O11 tRNA-Leu
  1887. Escherichia coli O120:H10 tRNA-Leu
  1888. Escherichia coli O121:H19 str. 03-3227 tRNA-Leu
  1889. Escherichia coli O121:H19 str. 06-3003 tRNA-Leu
  1890. Escherichia coli O121:H19 str. 06-3822 tRNA-Leu
  1891. Escherichia coli O121:H19 str. 2009C-4050 tRNA-Leu
  1892. Escherichia coli O121:H19 str. 2009C-4659 tRNA-Leu
  1893. Escherichia coli O121:H19 str. 2009C-4750 tRNA-Leu
  1894. Escherichia coli O121:H19 str. 2009EL1302 tRNA-Leu
  1895. Escherichia coli O121:H19 str. 2009EL1412 tRNA-Leu
  1896. Escherichia coli O121:H19 str. 2010C-3609 tRNA-Leu
  1897. Escherichia coli O121:H19 str. 2010C-3794 tRNA-Leu
  1898. Escherichia coli O121:H19 str. 2010C-3840 tRNA-Leu
  1899. Escherichia coli O121:H19 str. 2010C-4254 tRNA-Leu
  1900. Escherichia coli O121:H19 str. 2010C-4732 tRNA-Leu
  1901. Escherichia coli O121:H19 str. 2010C-4824 tRNA-Leu
  1902. Escherichia coli O121:H19 str. 2010C-4966 tRNA-Leu
  1903. Escherichia coli O121:H19 str. 2010C-4989 tRNA-Leu
  1904. Escherichia coli O121:H19 str. 2010EL1058 tRNA-Leu
  1905. Escherichia coli O121:H19 str. 2011C-3072 tRNA-Leu
  1906. Escherichia coli O121:H19 str. 2011C-3108 tRNA-Leu
  1907. Escherichia coli O121:H19 str. 2011C-3216 tRNA-Leu
  1908. Escherichia coli O121:H19 str. 2011C-3500 tRNA-Leu
  1909. Escherichia coli O121:H19 str. 2011C-3537 tRNA-Leu
  1910. Escherichia coli O121:H19 str. 2011C-3609 tRNA-Leu
  1911. Escherichia coli O121:H19 str. F6714 tRNA-Leu
  1912. Escherichia coli O121:H19 str. K5198 tRNA-Leu
  1913. Escherichia coli O121:H19 str. K5269 tRNA-Leu
  1914. Escherichia coli O121:H19 tRNA-Leu
  1915. Escherichia coli O121:H7 str. 2009C-3299 tRNA-Leu
  1916. Escherichia coli O121 str. RM8352 tRNA-Leu
  1917. Escherichia coli O121 tRNA-Leu
  1918. Escherichia coli O123:H11 str. 2009C-3307 tRNA-Leu
  1919. Escherichia coli O124 tRNA-Leu
  1920. Escherichia coli O125ac:K+:H10 tRNA-Leu
  1921. Escherichia coli O126:H45 tRNA-Leu
  1922. Escherichia coli O126 tRNA-Leu
  1923. Escherichia coli O127:H27 str. C43/90 tRNA-Leu
  1924. Escherichia coli O127:H6 str. E2348/69 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  1925. Escherichia coli O127:H6 tRNA-Leu
  1926. Escherichia coli O128ac:H12 tRNA-Leu
  1927. Escherichia coli O128:H2 str. 2011C-3317 tRNA-Leu
  1928. Escherichia coli O128:H42 tRNA-Leu
  1929. Escherichia coli O130 tRNA-Leu
  1930. Escherichia coli O132 tRNA-Leu
  1931. Escherichia coli O136:H26 tRNA-Leu
  1932. Escherichia coli O139:H1 tRNA-Leu
  1933. Escherichia coli O139:H28 str. E24377A tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  1934. Escherichia coli O13 tRNA-Leu
  1935. Escherichia coli O140 tRNA-Leu
  1936. Escherichia coli O141:H4 tRNA-Leu
  1937. Escherichia coli O143:H4 tRNA-Leu
  1938. Escherichia coli O144 tRNA-Leu
  1939. Escherichia coli O145:H25 str. 07-3858 tRNA-Leu
  1940. Escherichia coli O145:H25 tRNA-Leu
  1941. Escherichia coli O145:H28 str. 2009C-3292 tRNA-Leu
  1942. Escherichia coli O145:H28 str. 4865/96 tRNA-Leu
  1943. Escherichia coli O145:H28 str. RM12581 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  1944. Escherichia coli O145:H28 str. RM12761 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  1945. Escherichia coli O145:H28 str. RM13514 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  1946. Escherichia coli O145:H28 str. RM13516 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  1947. Escherichia coli O145:H28 tRNA-Leu
  1948. Escherichia coli O145:H34 tRNA-Leu
  1949. Escherichia coli O145:NM str. 06-3484 tRNA-Leu
  1950. Escherichia coli O145:NM str. 08-4270 tRNA-Leu
  1951. Escherichia coli O145:NM str. 2010C-3507 tRNA-Leu
  1952. Escherichia coli O145:NM str. 2010C-3508 tRNA-Leu
  1953. Escherichia coli O145:NM str. 2010C-3509 tRNA-Leu
  1954. Escherichia coli O145:NM str. 2010C-3510 tRNA-Leu
  1955. Escherichia coli O145:NM str. 2010C-3511 tRNA-Leu
  1956. Escherichia coli O145:NM str. 2010C-3516 tRNA-Leu
  1957. Escherichia coli O145:NM str. 2010C-3517 tRNA-Leu
  1958. Escherichia coli O145:NM str. 2010C-3518 tRNA-Leu
  1959. Escherichia coli O145:NM str. 2010C-3521 tRNA-Leu
  1960. Escherichia coli O145:NM str. 2010C-3526 tRNA-Leu
  1961. Escherichia coli O145:NM str. 2010C-4557C2 tRNA-Leu
  1962. Escherichia coli O145:NM tRNA-Leu
  1963. Escherichia coli O145 str. RM9872 tRNA-Leu
  1964. Escherichia coli O145 tRNA-Leu
  1965. Escherichia coli O146:H21 str. 2010C-3325 tRNA-Leu
  1966. Escherichia coli O146 tRNA-Leu
  1967. Escherichia coli O150:H6 tRNA-Leu
  1968. Escherichia coli O150 tRNA-Leu
  1969. Escherichia coli O151:H8 tRNA-Leu
  1970. Escherichia coli O152:H23 tRNA-Leu
  1971. Escherichia coli O153:H12 tRNA-Leu
  1972. Escherichia coli O153:H2 str. 2010C-5034 tRNA-Leu
  1973. Escherichia coli O153 tRNA-Leu
  1974. Escherichia coli O155:H21 tRNA-Leu
  1975. Escherichia coli O155 tRNA-Leu
  1976. Escherichia coli O156:H25 str. 2011C-3602 tRNA-Leu
  1977. Escherichia coli O157:H16 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  1978. Escherichia coli O157:H43 str. T22 tRNA-Leu
  1979. Escherichia coli O157:H43 tRNA-Leu
  1980. Escherichia coli O157:H7 str. 06-3745 tRNA-Leu
  1981. Escherichia coli O157:H7 str. 06-4039 tRNA-Leu
  1982. Escherichia coli O157:H7 str. 07-3091 tRNA-Leu
  1983. Escherichia coli O157:H7 str. 07-3391 tRNA-Leu
  1984. Escherichia coli O157:H7 str. 08-3037 tRNA-Leu
  1985. Escherichia coli O157:H7 str. 08-3527 tRNA-Leu
  1986. Escherichia coli O157:H7 str. 08-4169 tRNA-Leu
  1987. Escherichia coli O157:H7 str. 08-4529 tRNA-Leu
  1988. Escherichia coli O157:H7 str. 2009C-4258 tRNA-Leu
  1989. Escherichia coli O157:H7 str. 2009EL1449 tRNA-Leu
  1990. Escherichia coli O157:H7 str. 2009EL1705 tRNA-Leu
  1991. Escherichia coli O157:H7 str. 2009EL1913 tRNA-Leu
  1992. Escherichia coli O157:H7 str. 2009EL2109 tRNA-Leu
  1993. Escherichia coli O157:H7 str. 2010C-4979C1 tRNA-Leu
  1994. Escherichia coli O157:H7 str. 2011EL-1107 tRNA-Leu
  1995. Escherichia coli O157:H7 str. 2011EL-2090 tRNA-Leu
  1996. Escherichia coli O157:H7 str. 2011EL-2091 tRNA-Leu
  1997. Escherichia coli O157:H7 str. 2011EL-2092 tRNA-Leu
  1998. Escherichia coli O157:H7 str. 2011EL-2093 tRNA-Leu
  1999. Escherichia coli O157:H7 str. 2011EL-2094 tRNA-Leu
  2000. Escherichia coli O157:H7 str. 2011EL-2096 tRNA-Leu
  2001. Escherichia coli O157:H7 str. 2011EL-2097 tRNA-Leu
  2002. Escherichia coli O157:H7 str. 2011EL-2098 tRNA-Leu
  2003. Escherichia coli O157:H7 str. 2011EL-2099 tRNA-Leu
  2004. Escherichia coli O157:H7 str. 2011EL-2101 tRNA-Leu
  2005. Escherichia coli O157:H7 str. 2011EL-2103 tRNA-Leu
  2006. Escherichia coli O157:H7 str. 2011EL-2104 tRNA-Leu
  2007. Escherichia coli O157:H7 str. 2011EL-2105 tRNA-Leu
  2008. Escherichia coli O157:H7 str. 2011EL-2106 tRNA-Leu
  2009. Escherichia coli O157:H7 str. 2011EL-2107 tRNA-Leu
  2010. Escherichia coli O157:H7 str. 2011EL-2108 tRNA-Leu
  2011. Escherichia coli O157:H7 str. 2011EL-2109 tRNA-Leu
  2012. Escherichia coli O157:H7 str. 2011EL-2111 tRNA-Leu
  2013. Escherichia coli O157:H7 str. 2011EL-2112 tRNA-Leu
  2014. Escherichia coli O157:H7 str. 2011EL-2113 tRNA-Leu
  2015. Escherichia coli O157:H7 str. 2011EL-2114 tRNA-Leu
  2016. Escherichia coli O157:H7 str. 2011EL-2286 tRNA-Leu
  2017. Escherichia coli O157:H7 str. 2011EL-2287 tRNA-Leu
  2018. Escherichia coli O157:H7 str. 2011EL-2288 tRNA-Leu
  2019. Escherichia coli O157:H7 str. 2011EL-2289 tRNA-Leu
  2020. Escherichia coli O157:H7 str. 2011EL-2290 tRNA-Leu
  2021. Escherichia coli O157:H7 str. 2011EL-2312 tRNA-Leu
  2022. Escherichia coli O157:H7 str. 2011EL-2313 tRNA-Leu
  2023. Escherichia coli O157:H7 str. EC10 tRNA-Leu
  2024. Escherichia coli O157:H7 str. EC1825 tRNA-Leu
  2025. Escherichia coli O157:H7 str. EC4115 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2026. Escherichia coli O157:H7 str. EDL933 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2027. Escherichia coli O157:H7 str. F6142 tRNA-Leu
  2028. Escherichia coli O157:H7 str. F6749 tRNA-Leu
  2029. Escherichia coli O157:H7 str. F6750 tRNA-Leu
  2030. Escherichia coli O157:H7 str. F6751 tRNA-Leu
  2031. Escherichia coli O157:H7 str. F7350 tRNA-Leu
  2032. Escherichia coli O157:H7 str. F7377 tRNA-Leu
  2033. Escherichia coli O157:H7 str. F7384 tRNA-Leu
  2034. Escherichia coli O157:H7 str. F7410 tRNA-Leu
  2035. Escherichia coli O157:H7 str. F8092B tRNA-Leu
  2036. Escherichia coli O157:H7 str. G5101 tRNA-Leu
  2037. Escherichia coli O157:H7 str. G5303 tRNA-Leu
  2038. Escherichia coli O157:H7 str. H2495 tRNA-Leu
  2039. Escherichia coli O157:H7 str. H2498 tRNA-Leu
  2040. Escherichia coli O157:H7 str. K1420 tRNA-Leu
  2041. Escherichia coli O157:H7 str. K1792 tRNA-Leu
  2042. Escherichia coli O157:H7 str. K1793 tRNA-Leu
  2043. Escherichia coli O157:H7 str. K1795 tRNA-Leu
  2044. Escherichia coli O157:H7 str. K1796 tRNA-Leu
  2045. Escherichia coli O157:H7 str. K1845 tRNA-Leu
  2046. Escherichia coli O157:H7 str. K1921 tRNA-Leu
  2047. Escherichia coli O157:H7 str. K1927 tRNA-Leu
  2048. Escherichia coli O157:H7 str. K2188 tRNA-Leu
  2049. Escherichia coli O157:H7 str. K2191 tRNA-Leu
  2050. Escherichia coli O157:H7 str. K2192 tRNA-Leu
  2051. Escherichia coli O157:H7 str. K2324 tRNA-Leu
  2052. Escherichia coli O157:H7 str. K2581 tRNA-Leu
  2053. Escherichia coli O157:H7 str. K2622 tRNA-Leu
  2054. Escherichia coli O157:H7 str. K2845 tRNA-Leu
  2055. Escherichia coli O157:H7 str. K2854 tRNA-Leu
  2056. Escherichia coli O157:H7 str. K4396 tRNA-Leu
  2057. Escherichia coli O157:H7 str. K4405 tRNA-Leu
  2058. Escherichia coli O157:H7 str. K4406 tRNA-Leu
  2059. Escherichia coli O157:H7 str. K4527 tRNA-Leu
  2060. Escherichia coli O157:H7 str. K5418 tRNA-Leu
  2061. Escherichia coli O157:H7 str. K5448 tRNA-Leu
  2062. Escherichia coli O157:H7 str. K5449 tRNA-Leu
  2063. Escherichia coli O157:H7 str. K5453 tRNA-Leu
  2064. Escherichia coli O157:H7 str. K5460 tRNA-Leu
  2065. Escherichia coli O157:H7 str. K5467 tRNA-Leu
  2066. Escherichia coli O157:H7 str. K5602 tRNA-Leu
  2067. Escherichia coli O157:H7 str. K5607 tRNA-Leu
  2068. Escherichia coli O157:H7 str. K5609 tRNA-Leu
  2069. Escherichia coli O157:H7 str. K5806 tRNA-Leu
  2070. Escherichia coli O157:H7 str. K5852 tRNA-Leu
  2071. Escherichia coli O157:H7 str. K6590 tRNA-Leu
  2072. Escherichia coli O157:H7 str. K6676 tRNA-Leu
  2073. Escherichia coli O157:H7 str. K6687 tRNA-Leu
  2074. Escherichia coli O157:H7 str. K7140 tRNA-Leu
  2075. Escherichia coli O157:H7 str. LSU-61 tRNA-Leu
  2076. Escherichia coli O157:H7 str. Sakai tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2077. Escherichia coli O157:H7 str. SS17 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2078. Escherichia coli O157:H7 str. SS52 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2079. Escherichia coli O157:H7 str. TW14313 tRNA-Leu
  2080. Escherichia coli O157:H7 str. TW14359 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2081. Escherichia coli O157:H7 tRNA-Leu
  2082. Escherichia coli O157:H- str. 493-89 tRNA-Leu
  2083. Escherichia coli O157:H- str. H 2687 tRNA-Leu
  2084. Escherichia coli O157:H- tRNA-Leu
  2085. Escherichia coli O157:NM str. 08-4540 tRNA-Leu
  2086. Escherichia coli O157:NM tRNA-Leu
  2087. Escherichia coli O157: str. 2010EL-2044 tRNA-Leu
  2088. Escherichia coli O157: str. 2010EL-2045 tRNA-Leu
  2089. Escherichia coli O157 tRNA-Leu
  2090. Escherichia coli O158:H23 tRNA-Leu
  2091. Escherichia coli O159:H19 tRNA-Leu
  2092. Escherichia coli O15:H12 tRNA-Leu
  2093. Escherichia coli O15:H18 str. K1516 tRNA-Leu
  2094. Escherichia coli O15:H18 tRNA-Leu
  2095. Escherichia coli O15:H21 tRNA-Leu
  2096. Escherichia coli O15 tRNA-Leu
  2097. Escherichia coli O160 tRNA-Leu
  2098. Escherichia coli O163 tRNA-Leu
  2099. Escherichia coli O165:H25 str. 2010C-4874 tRNA-Leu
  2100. Escherichia coli O166:H49 tRNA-Leu
  2101. Escherichia coli O166:H6 tRNA-Leu
  2102. Escherichia coli O167:H26 tRNA-Leu
  2103. Escherichia coli O167:H9 tRNA-Leu
  2104. Escherichia coli O168:H8 tRNA-Leu
  2105. Escherichia coli O168 tRNA-Leu
  2106. Escherichia coli O169:H41 str. F9792 tRNA-Leu
  2107. Escherichia coli O16:H48 tRNA-Leu
  2108. Escherichia coli O16 tRNA-Leu
  2109. Escherichia coli O170:H18 tRNA-Leu
  2110. Escherichia coli O170 tRNA-Leu
  2111. Escherichia coli O171 tRNA-Leu
  2112. Escherichia coli O174:H21 str. 03-3269 tRNA-Leu
  2113. Escherichia coli O174:H21 tRNA-Leu
  2114. Escherichia coli O174:H7 tRNA-Leu
  2115. Escherichia coli O174:H8 str. 04-3038 tRNA-Leu
  2116. Escherichia coli O174 tRNA-Leu
  2117. Escherichia coli O176:H45 tRNA-Leu
  2118. Escherichia coli O177:NM str. 2010C-4558 tRNA-Leu
  2119. Escherichia coli O177 tRNA-Leu
  2120. Escherichia coli O180:H14 tRNA-Leu
  2121. Escherichia coli O18ac:H14 tRNA-Leu
  2122. Escherichia coli O18:H1 tRNA-Leu
  2123. Escherichia coli O18:H7 tRNA-Leu
  2124. Escherichia coli O19:H42 tRNA-Leu
  2125. Escherichia coli O19:H7 tRNA-Leu
  2126. Escherichia coli O19 tRNA-Leu
  2127. Escherichia coli O1:H42 tRNA-Leu
  2128. Escherichia coli O1:H7 tRNA-Leu
  2129. Escherichia coli O1:HNT tRNA-Leu
  2130. Escherichia coli O20:H12 tRNA-Leu
  2131. Escherichia coli O21:H28 tRNA-Leu
  2132. Escherichia coli O21 tRNA-Leu
  2133. Escherichia coli O22:H8 tRNA-Leu
  2134. Escherichia coli O22 tRNA-Leu
  2135. Escherichia coli O24 tRNA-Leu
  2136. Escherichia coli O25b:H4-ST131 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2137. Escherichia coli O25b:H4 tRNA-Leu
  2138. Escherichia coli O25:H4 tRNA-Leu
  2139. Escherichia coli O25:NM str. E2539C1 tRNA-Leu
  2140. Escherichia coli O25 tRNA-Leu
  2141. Escherichia coli O26:H11 str. 03-3500 tRNA-Leu
  2142. Escherichia coli O26:H11 str. 05-3646 tRNA-Leu
  2143. Escherichia coli O26:H11 str. 06-3464 tRNA-Leu
  2144. Escherichia coli O26:H11 str. 11368 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2145. Escherichia coli O26:H11 str. 2009C-3612 tRNA-Leu
  2146. Escherichia coli O26:H11 str. 2009C-3689 tRNA-Leu
  2147. Escherichia coli O26:H11 str. 2009C-3996 tRNA-Leu
  2148. Escherichia coli O26:H11 str. 2009C-4760 tRNA-Leu
  2149. Escherichia coli O26:H11 str. 2009C-4826 tRNA-Leu
  2150. Escherichia coli O26:H11 str. 2010C-3051 tRNA-Leu
  2151. Escherichia coli O26:H11 str. 2010C-3472 tRNA-Leu
  2152. Escherichia coli O26:H11 str. 2010C-3871 tRNA-Leu
  2153. Escherichia coli O26:H11 str. 2010C-3902 tRNA-Leu
  2154. Escherichia coli O26:H11 str. 2010C-4244 tRNA-Leu
  2155. Escherichia coli O26:H11 str. 2010C-4430 tRNA-Leu
  2156. Escherichia coli O26:H11 str. 2010C-4819 tRNA-Leu
  2157. Escherichia coli O26:H11 str. 2010C-4834 tRNA-Leu
  2158. Escherichia coli O26:H11 str. 2010C-5028 tRNA-Leu
  2159. Escherichia coli O26:H11 str. 2010EL-1699 tRNA-Leu
  2160. Escherichia coli O26:H11 str. 2011C-3270 tRNA-Leu
  2161. Escherichia coli O26:H11 str. 2011C-3274 tRNA-Leu
  2162. Escherichia coli O26:H11 str. 2011C-3282 tRNA-Leu
  2163. Escherichia coli O26:H11 str. 2011C-3387 tRNA-Leu
  2164. Escherichia coli O26:H11 str. 2011C-3506 tRNA-Leu
  2165. Escherichia coli O26:H11 str. 2011C-3655 tRNA-Leu
  2166. Escherichia coli O26:H11 str. CFSAN001629 tRNA-Leu
  2167. Escherichia coli O26:H11 str. CVM10021 tRNA-Leu
  2168. Escherichia coli O26:H11 str. CVM10026 tRNA-Leu
  2169. Escherichia coli O26:H11 str. CVM10030 tRNA-Leu
  2170. Escherichia coli O26:H11 str. CVM10224 tRNA-Leu
  2171. Escherichia coli O26:H11 str. CVM9942 tRNA-Leu
  2172. Escherichia coli O26:H11 str. CVM9952 tRNA-Leu
  2173. Escherichia coli O26:H11 tRNA-Leu
  2174. Escherichia coli O26:H1 str. 2009C-4747 tRNA-Leu
  2175. Escherichia coli O26:NM str. 2010C-4347 tRNA-Leu
  2176. Escherichia coli O26:NM str. 2010C-4788 tRNA-Leu
  2177. Escherichia coli O26 str. RM10386 tRNA-Leu
  2178. Escherichia coli O26 str. RM8426 tRNA-Leu
  2179. Escherichia coli O26 tRNA-Leu
  2180. Escherichia coli O28ac:NM str. 02-3404 tRNA-Leu
  2181. Escherichia coli O2:H14 tRNA-Leu
  2182. Escherichia coli O2:H1 tRNA-Leu
  2183. Escherichia coli O2:H32 tRNA-Leu
  2184. Escherichia coli O2:H6 tRNA-Leu
  2185. Escherichia coli O2:K2:H1 tRNA-Leu
  2186. Escherichia coli O2 tRNA-Leu
  2187. Escherichia coli O32:H37 str. P4 tRNA-Leu
  2188. Escherichia coli O32 tRNA-Leu
  2189. Escherichia coli O33 tRNA-Leu
  2190. Escherichia coli O35 tRNA-Leu
  2191. Escherichia coli O36:H5 tRNA-Leu
  2192. Escherichia coli O36 tRNA-Leu
  2193. Escherichia coli O38:H26 tRNA-Leu
  2194. Escherichia coli O39:H21 tRNA-Leu
  2195. Escherichia coli O39:H4 tRNA-Leu
  2196. Escherichia coli O3 tRNA-Leu
  2197. Escherichia coli O40:H32 tRNA-Leu
  2198. Escherichia coli O43:H14 tRNA-Leu
  2199. Escherichia coli O43:H2 tRNA-Leu
  2200. Escherichia coli O43 str. RM10042 tRNA-Leu
  2201. Escherichia coli O43 tRNA-Leu
  2202. Escherichia coli O45:H2 str. 01-3147 tRNA-Leu
  2203. Escherichia coli O45:H2 str. 2009C-3686 tRNA-Leu
  2204. Escherichia coli O45:H2 str. 2009C-4780 tRNA-Leu
  2205. Escherichia coli O45:H2 str. 2010C-3876 tRNA-Leu
  2206. Escherichia coli O45:H2 str. 2010C-4211 tRNA-Leu
  2207. Escherichia coli O45:H2 tRNA-Leu
  2208. Escherichia coli O49:H9 tRNA-Leu
  2209. Escherichia coli O53 tRNA-Leu
  2210. Escherichia coli O54 tRNA-Leu
  2211. Escherichia coli O55:H7 str. 06-3555 tRNA-Leu
  2212. Escherichia coli O55:H7 str. 3256-97 tRNA-Leu
  2213. Escherichia coli O55:H7 str. CB9615 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2214. Escherichia coli O55:H7 str. RM12579 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2215. Escherichia coli O55:H7 str. TB182A tRNA-Leu
  2216. Escherichia coli O55:H7 str. USDA 5905 tRNA-Leu
  2217. Escherichia coli O55:H7 tRNA-Leu
  2218. Escherichia coli O55 tRNA-Leu
  2219. Escherichia coli O5:K4(L):H4 str. ATCC 23502 tRNA-Leu-CAA
  2220. Escherichia coli O5 tRNA-Leu
  2221. Escherichia coli O68:H12 tRNA-Leu
  2222. Escherichia coli O69:H11 str. 06-3325 tRNA-Leu
  2223. Escherichia coli O69:H11 str. 07-3763 tRNA-Leu
  2224. Escherichia coli O69:H11 str. 07-4281 tRNA-Leu
  2225. Escherichia coli O69:H11 str. 08-4661 tRNA-Leu
  2226. Escherichia coli O69:H11 str. 2009C-3601 tRNA-Leu
  2227. Escherichia coli O6:H16:CFA/II str. B2C tRNA-Leu
  2228. Escherichia coli O6:H16 str. 99-3165 tRNA-Leu
  2229. Escherichia coli O6:H16 str. F5656C1 tRNA-Leu
  2230. Escherichia coli O6:H34 tRNA-Leu
  2231. Escherichia coli O6:K2:H1 tRNA-Leu
  2232. Escherichia coli O6 tRNA-Leu
  2233. Escherichia coli O70:H25 tRNA-Leu
  2234. Escherichia coli O73 tRNA-Leu
  2235. Escherichia coli O74:H8 tRNA-Leu
  2236. Escherichia coli O74 tRNA-Leu
  2237. Escherichia coli O78:H12 str. 00-3279 tRNA-Leu
  2238. Escherichia coli O78:H42 tRNA-Leu
  2239. Escherichia coli O78:H4 tRNA-Leu
  2240. Escherichia coli O78 tRNA-Leu
  2241. Escherichia coli O79:H7 str. 06-3501 tRNA-Leu
  2242. Escherichia coli O79 tRNA-Leu
  2243. Escherichia coli O7:H4 tRNA-Leu
  2244. Escherichia coli O7:H7 tRNA-Leu
  2245. Escherichia coli O7:K1 str. CE10 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2246. Escherichia coli O80:H26 tRNA-Leu
  2247. Escherichia coli O80:H45 tRNA-Leu
  2248. Escherichia coli O81:NM str. 02-3012 tRNA-Leu
  2249. Escherichia coli O82 tRNA-Leu
  2250. Escherichia coli O83:H1 str. NRG 857C tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2251. Escherichia coli O83:H31 tRNA-Leu
  2252. Escherichia coli O83w tRNA-Leu
  2253. Escherichia coli O84:H7 tRNA-Leu
  2254. Escherichia coli O85:H1 tRNA-Leu
  2255. Escherichia coli O86:H34 str. 99-3124 tRNA-Leu
  2256. Escherichia coli O86:H8 tRNA-Leu
  2257. Escherichia coli O88:H1 tRNA-Leu
  2258. Escherichia coli O88:H4 tRNA-Leu
  2259. Escherichia coli O89m:H10 tRNA-Leu
  2260. Escherichia coli O89m:H9 tRNA-Leu
  2261. Escherichia coli O8:H10 tRNA-Leu
  2262. Escherichia coli O8:H19 tRNA-Leu
  2263. Escherichia coli O8:H28 tRNA-Leu
  2264. Escherichia coli O8:H31 tRNA-Leu
  2265. Escherichia coli O8:H36 tRNA-Leu
  2266. Escherichia coli O8:H49 tRNA-Leu
  2267. Escherichia coli O8:H8 tRNA-Leu
  2268. Escherichia coli O8:H9 tRNA-Leu
  2269. Escherichia coli O8 tRNA-Leu
  2270. Escherichia coli O91:H14 str. 2009C-3227 tRNA-Leu
  2271. Escherichia coli O91:H21 str. 2009C-3740 tRNA-Leu
  2272. Escherichia coli O91:H21 str. 2009C-4646 tRNA-Leu
  2273. Escherichia coli O91:H21 tRNA-Leu
  2274. Escherichia coli O91:H28 tRNA-Leu
  2275. Escherichia coli O91:NM str. 2009C-3745 tRNA-Leu
  2276. Escherichia coli O91 str. RM7190 tRNA-Leu
  2277. Escherichia coli O91 tRNA-Leu
  2278. Escherichia coli O96 tRNA-Leu
  2279. Escherichia coli O99:H27 tRNA-Leu
  2280. Escherichia coli O9:H10 tRNA-Leu
  2281. Escherichia coli OK1180 tRNA-Leu
  2282. Escherichia coli OK1357 tRNA-Leu
  2283. Escherichia coli ONT:H33 str. C48/93 tRNA-Leu
  2284. Escherichia coli OP50 tRNA-Leu
  2285. Escherichia coli OX01:H8 tRNA-Leu
  2286. Escherichia coli OX38:H47 tRNA-Leu
  2287. Escherichia coli P0298942.10 tRNA-Leu
  2288. Escherichia coli P0298942.11 tRNA-Leu
  2289. Escherichia coli P0298942.12 tRNA-Leu
  2290. Escherichia coli P0298942.14 tRNA-Leu
  2291. Escherichia coli P0298942.15 tRNA-Leu
  2292. Escherichia coli P0298942.1 tRNA-Leu
  2293. Escherichia coli P0298942.2 tRNA-Leu
  2294. Escherichia coli P0298942.3 tRNA-Leu
  2295. Escherichia coli P0298942.4 tRNA-Leu
  2296. Escherichia coli P0298942.6 tRNA-Leu
  2297. Escherichia coli P0298942.7 tRNA-Leu
  2298. Escherichia coli P0298942.8 tRNA-Leu
  2299. Escherichia coli P0298942.9 tRNA-Leu
  2300. Escherichia coli P0299438.10 tRNA-Leu
  2301. Escherichia coli P0299438.11 tRNA-Leu
  2302. Escherichia coli P0299438.2 tRNA-Leu
  2303. Escherichia coli P0299438.3 tRNA-Leu
  2304. Escherichia coli P0299438.4 tRNA-Leu
  2305. Escherichia coli P0299438.5 tRNA-Leu
  2306. Escherichia coli P0299438.6 tRNA-Leu
  2307. Escherichia coli P0299438.7 tRNA-Leu
  2308. Escherichia coli P0299438.8 tRNA-Leu
  2309. Escherichia coli P0299438.9 tRNA-Leu
  2310. Escherichia coli P0299483.1 tRNA-Leu
  2311. Escherichia coli P0299483.2 tRNA-Leu
  2312. Escherichia coli P0299483.3 tRNA-Leu
  2313. Escherichia coli P0299917.10 tRNA-Leu
  2314. Escherichia coli P0299917.1 tRNA-Leu
  2315. Escherichia coli P0299917.2 tRNA-Leu
  2316. Escherichia coli P0299917.3 tRNA-Leu
  2317. Escherichia coli P0299917.4 tRNA-Leu
  2318. Escherichia coli P0299917.5 tRNA-Leu
  2319. Escherichia coli P0299917.6 tRNA-Leu
  2320. Escherichia coli P0299917.7 tRNA-Leu
  2321. Escherichia coli P0299917.8 tRNA-Leu
  2322. Escherichia coli P0299917.9 tRNA-Leu
  2323. Escherichia coli P0301867.11 tRNA-Leu
  2324. Escherichia coli P0301867.13 tRNA-Leu
  2325. Escherichia coli P0301867.1 tRNA-Leu
  2326. Escherichia coli P0301867.2 tRNA-Leu
  2327. Escherichia coli P0301867.3 tRNA-Leu
  2328. Escherichia coli P0301867.4 tRNA-Leu
  2329. Escherichia coli P0301867.5 tRNA-Leu
  2330. Escherichia coli P0301867.7 tRNA-Leu
  2331. Escherichia coli P0301867.8 tRNA-Leu
  2332. Escherichia coli P0301904.3 tRNA-Leu
  2333. Escherichia coli P0302293.10 tRNA-Leu
  2334. Escherichia coli P0302293.2 tRNA-Leu
  2335. Escherichia coli P0302293.3 tRNA-Leu
  2336. Escherichia coli P0302293.4 tRNA-Leu
  2337. Escherichia coli P0302293.6 tRNA-Leu
  2338. Escherichia coli P0302293.7 tRNA-Leu
  2339. Escherichia coli P0302293.8 tRNA-Leu
  2340. Escherichia coli P0302293.9 tRNA-Leu
  2341. Escherichia coli P0302308.10 tRNA-Leu
  2342. Escherichia coli P0302308.11 tRNA-Leu
  2343. Escherichia coli P0302308.12 tRNA-Leu
  2344. Escherichia coli P0302308.13 tRNA-Leu
  2345. Escherichia coli P0302308.14 tRNA-Leu
  2346. Escherichia coli P0302308.1 tRNA-Leu
  2347. Escherichia coli P0302308.2 tRNA-Leu
  2348. Escherichia coli P0302308.3 tRNA-Leu
  2349. Escherichia coli P0302308.4 tRNA-Leu
  2350. Escherichia coli P0302308.5 tRNA-Leu
  2351. Escherichia coli P0304777.10 tRNA-Leu
  2352. Escherichia coli P0304777.11 tRNA-Leu
  2353. Escherichia coli P0304777.12 tRNA-Leu
  2354. Escherichia coli P0304777.13 tRNA-Leu
  2355. Escherichia coli P0304777.14 tRNA-Leu
  2356. Escherichia coli P0304777.15 tRNA-Leu
  2357. Escherichia coli P0304777.1 tRNA-Leu
  2358. Escherichia coli P0304777.2 tRNA-Leu
  2359. Escherichia coli P0304777.3 tRNA-Leu
  2360. Escherichia coli P0304777.4 tRNA-Leu
  2361. Escherichia coli P0304777.5 tRNA-Leu
  2362. Escherichia coli P0304777.7 tRNA-Leu
  2363. Escherichia coli P0304777.8 tRNA-Leu
  2364. Escherichia coli P0304777.9 tRNA-Leu
  2365. Escherichia coli P0304799.3 tRNA-Leu
  2366. Escherichia coli P0304816.10 tRNA-Leu
  2367. Escherichia coli P0304816.11 tRNA-Leu
  2368. Escherichia coli P0304816.12 tRNA-Leu
  2369. Escherichia coli P0304816.13 tRNA-Leu
  2370. Escherichia coli P0304816.14 tRNA-Leu
  2371. Escherichia coli P0304816.15 tRNA-Leu
  2372. Escherichia coli P0304816.1 tRNA-Leu
  2373. Escherichia coli P0304816.2 tRNA-Leu
  2374. Escherichia coli P0304816.3 tRNA-Leu
  2375. Escherichia coli P0304816.4 tRNA-Leu
  2376. Escherichia coli P0304816.5 tRNA-Leu
  2377. Escherichia coli P0304816.6 tRNA-Leu
  2378. Escherichia coli P0304816.7 tRNA-Leu
  2379. Escherichia coli P0304816.8 tRNA-Leu
  2380. Escherichia coli P0304816.9 tRNA-Leu
  2381. Escherichia coli P0305260.10 tRNA-Leu
  2382. Escherichia coli P0305260.11 tRNA-Leu
  2383. Escherichia coli P0305260.12 tRNA-Leu
  2384. Escherichia coli P0305260.13 tRNA-Leu
  2385. Escherichia coli P0305260.15 tRNA-Leu
  2386. Escherichia coli P0305260.1 tRNA-Leu
  2387. Escherichia coli P0305260.2 tRNA-Leu
  2388. Escherichia coli P0305260.3 tRNA-Leu
  2389. Escherichia coli P0305260.4 tRNA-Leu
  2390. Escherichia coli P0305260.5 tRNA-Leu
  2391. Escherichia coli P0305260.6 tRNA-Leu
  2392. Escherichia coli P0305260.7 tRNA-Leu
  2393. Escherichia coli P0305260.8 tRNA-Leu
  2394. Escherichia coli P0305260.9 tRNA-Leu
  2395. Escherichia coli p0305293.10 tRNA-Leu
  2396. Escherichia coli p0305293.11 tRNA-Leu
  2397. Escherichia coli p0305293.12 tRNA-Leu
  2398. Escherichia coli p0305293.13 tRNA-Leu
  2399. Escherichia coli p0305293.15 tRNA-Leu
  2400. Escherichia coli p0305293.1 tRNA-Leu
  2401. Escherichia coli p0305293.2 tRNA-Leu
  2402. Escherichia coli p0305293.3 tRNA-Leu
  2403. Escherichia coli p0305293.4 tRNA-Leu
  2404. Escherichia coli p0305293.5 tRNA-Leu
  2405. Escherichia coli p0305293.6 tRNA-Leu
  2406. Escherichia coli p0305293.7 tRNA-Leu
  2407. Escherichia coli p0305293.8 tRNA-Leu
  2408. Escherichia coli p0305293.9 tRNA-Leu
  2409. Escherichia coli P12b tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2410. Escherichia coli P4-96 tRNA-Leu
  2411. Escherichia coli P4-NR tRNA-Leu
  2412. Escherichia coli PA10 tRNA-Leu
  2413. Escherichia coli PA11 tRNA-Leu
  2414. Escherichia coli PA13 tRNA-Leu
  2415. Escherichia coli PA14 tRNA-Leu
  2416. Escherichia coli PA15 tRNA-Leu
  2417. Escherichia coli PA22 tRNA-Leu
  2418. Escherichia coli PA23 tRNA-Leu
  2419. Escherichia coli PA24 tRNA-Leu
  2420. Escherichia coli PA25 tRNA-Leu
  2421. Escherichia coli PA28 tRNA-Leu
  2422. Escherichia coli PA2 tRNA-Leu
  2423. Escherichia coli PA31 tRNA-Leu
  2424. Escherichia coli PA32 tRNA-Leu
  2425. Escherichia coli PA33 tRNA-Leu
  2426. Escherichia coli PA34 tRNA-Leu
  2427. Escherichia coli PA35 tRNA-Leu
  2428. Escherichia coli PA38 tRNA-Leu
  2429. Escherichia coli PA39 tRNA-Leu
  2430. Escherichia coli PA3 tRNA-Leu
  2431. Escherichia coli PA40 tRNA-Leu
  2432. Escherichia coli PA41 tRNA-Leu
  2433. Escherichia coli PA42 tRNA-Leu
  2434. Escherichia coli PA45 tRNA-Leu
  2435. Escherichia coli PA47 tRNA-Leu
  2436. Escherichia coli PA48 tRNA-Leu
  2437. Escherichia coli PA49 tRNA-Leu
  2438. Escherichia coli PA4 tRNA-Leu
  2439. Escherichia coli PA5 tRNA-Leu
  2440. Escherichia coli PA7 tRNA-Leu
  2441. Escherichia coli PA8 tRNA-Leu
  2442. Escherichia coli PA9 tRNA-Leu
  2443. Escherichia coli PCN009 tRNA-Leu
  2444. Escherichia coli PCN061 tRNA-Leu
  2445. Escherichia coli PCN079 tRNA-Leu
  2446. Escherichia coli PMV-1 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2447. Escherichia coli R424 tRNA-Leu
  2448. Escherichia coli R527 tRNA-Leu
  2449. Escherichia coli RN587/1 tRNA-Leu
  2450. Escherichia coli RS218 tRNA-Leu
  2451. Escherichia coli S17 tRNA-Leu
  2452. Escherichia coli S88 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2453. Escherichia coli SCI-07 tRNA-Leu
  2454. Escherichia coli SE11 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2455. Escherichia coli SE15 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2456. Escherichia coli SEPT362 tRNA-Leu
  2457. Escherichia coli SHECO001 tRNA-Leu
  2458. Escherichia coli SHECO002 tRNA-Leu
  2459. Escherichia coli SHECO003 tRNA-Leu
  2460. Escherichia coli SMS-3-5 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2461. Escherichia coli STEC_7v tRNA-Leu
  2462. Escherichia coli STEC_94C tRNA-Leu
  2463. Escherichia coli O91:H21 str. B2F1 tRNA-Leu
  2464. Escherichia coli STEC_C165-02 tRNA-Leu
  2465. Escherichia coli STEC_DG131-3 tRNA-Leu
  2466. Escherichia coli STEC_EH250 tRNA-Leu
  2467. Escherichia coli STEC_MHI813 tRNA-Leu
  2468. Escherichia coli STEC_O31 tRNA-Leu
  2469. Escherichia coli STEC_S1191 tRNA-Leu
  2470. Escherichia coli str. 'clone D i14' tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2471. Escherichia coli str. 'clone D i2' tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2472. Escherichia coli str. K-12 substr. DH10B tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2473. Escherichia coli str. K-12 substr. MC4100 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2474. Escherichia coli str. K-12 substr. MDS42 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2475. Escherichia coli str. K-12 substr. MG1655 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2476. Escherichia coli str. K-12 substr. W3110 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2477. Escherichia coli str. Sanji tRNA-Leu
  2478. Escherichia coli SWW33 tRNA-Leu
  2479. Escherichia coli T1282_01 tRNA-Leu
  2480. Escherichia coli T1840_97 tRNA-Leu
  2481. Escherichia coli T234_00 tRNA-Leu
  2482. Escherichia coli T426 tRNA-Leu
  2483. Escherichia coli T924_01 tRNA-Leu
  2484. Escherichia coli TA007 tRNA-Leu
  2485. Escherichia coli TA008 tRNA-Leu
  2486. Escherichia coli TA014 tRNA-Leu
  2487. Escherichia coli TA054 tRNA-Leu
  2488. Escherichia coli TA124 tRNA-Leu
  2489. Escherichia coli TA143 tRNA-Leu
  2490. Escherichia coli TA144 tRNA-Leu
  2491. Escherichia coli TA206 tRNA-Leu
  2492. Escherichia coli TA249 tRNA-Leu
  2493. Escherichia coli TA255 tRNA-Leu
  2494. Escherichia coli TA271 tRNA-Leu
  2495. Escherichia coli TA280 tRNA-Leu
  2496. Escherichia coli TA447 tRNA-Leu
  2497. Escherichia coli TA464 tRNA-Leu
  2498. Escherichia coli ThroopD tRNA-Leu
  2499. Escherichia coli tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2500. Escherichia coli TT12B tRNA-Leu
  2501. Escherichia coli TW00353 tRNA-Leu
  2502. Escherichia coli TW06591 tRNA-Leu
  2503. Escherichia coli TW07509 tRNA-Leu
  2504. Escherichia coli TW07793 tRNA-Leu
  2505. Escherichia coli TW07945 tRNA-Leu
  2506. Escherichia coli TW09098 tRNA-Leu
  2507. Escherichia coli TW09109 tRNA-Leu
  2508. Escherichia coli TW09195 tRNA-Leu
  2509. Escherichia coli TW10119 tRNA-Leu
  2510. Escherichia coli TW10246 tRNA-Leu
  2511. Escherichia coli TW10509 tRNA-Leu
  2512. Escherichia coli TW11039 tRNA-Leu
  2513. Escherichia coli TW14301 tRNA-Leu
  2514. Escherichia coli TW15901 tRNA-Leu
  2515. Escherichia coli Tx1686 tRNA-Leu
  2516. Escherichia coli TX1999 tRNA-Leu
  2517. Escherichia coli Tx3800 tRNA-Leu
  2518. Escherichia coli UCI 51 tRNA-Leu
  2519. Escherichia coli UCI 52 tRNA-Leu
  2520. Escherichia coli UCI 53 tRNA-Leu
  2521. Escherichia coli UCI 57 tRNA-Leu
  2522. Escherichia coli UCI 58 tRNA-Leu
  2523. Escherichia coli UCI 65 tRNA-Leu
  2524. Escherichia coli UCI 66 tRNA-Leu
  2525. Escherichia coli UM146 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2526. Escherichia coli UMEA 3014-1 tRNA-Leu
  2527. Escherichia coli UMEA 3022-1 tRNA-Leu
  2528. Escherichia coli UMEA 3033-1 tRNA-Leu
  2529. Escherichia coli UMEA 3041-1 tRNA-Leu
  2530. Escherichia coli UMEA 3052-1 tRNA-Leu
  2531. Escherichia coli UMEA 3065-1 tRNA-Leu
  2532. Escherichia coli UMEA 3087-1 tRNA-Leu
  2533. Escherichia coli UMEA 3088-1 tRNA-Leu
  2534. Escherichia coli UMEA 3097-1 tRNA-Leu
  2535. Escherichia coli UMEA 3108-1 tRNA-Leu
  2536. Escherichia coli UMEA 3113-1 tRNA-Leu
  2537. Escherichia coli UMEA 3117-1 tRNA-Leu
  2538. Escherichia coli UMEA 3121-1 tRNA-Leu
  2539. Escherichia coli UMEA 3122-1 tRNA-Leu
  2540. Escherichia coli UMEA 3124-1 tRNA-Leu
  2541. Escherichia coli UMEA 3139-1 tRNA-Leu
  2542. Escherichia coli UMEA 3140-1 tRNA-Leu
  2543. Escherichia coli UMEA 3144-1 tRNA-Leu
  2544. Escherichia coli UMEA 3148-1 tRNA-Leu
  2545. Escherichia coli UMEA 3150-1 tRNA-Leu
  2546. Escherichia coli UMEA 3151-1 tRNA-Leu
  2547. Escherichia coli UMEA 3152-1 tRNA-Leu
  2548. Escherichia coli UMEA 3155-1 tRNA-Leu
  2549. Escherichia coli UMEA 3159-1 tRNA-Leu
  2550. Escherichia coli UMEA 3160-1 tRNA-Leu
  2551. Escherichia coli UMEA 3161-1 tRNA-Leu
  2552. Escherichia coli UMEA 3162-1 tRNA-Leu
  2553. Escherichia coli UMEA 3163-1 tRNA-Leu
  2554. Escherichia coli UMEA 3172-1 tRNA-Leu
  2555. Escherichia coli UMEA 3173-1 tRNA-Leu
  2556. Escherichia coli UMEA 3174-1 tRNA-Leu
  2557. Escherichia coli UMEA 3175-1 tRNA-Leu
  2558. Escherichia coli UMEA 3176-1 tRNA-Leu
  2559. Escherichia coli UMEA 3178-1 tRNA-Leu
  2560. Escherichia coli UMEA 3180-1 tRNA-Leu
  2561. Escherichia coli UMEA 3185-1 tRNA-Leu
  2562. Escherichia coli UMEA 3190-1 tRNA-Leu
  2563. Escherichia coli UMEA 3193-1 tRNA-Leu
  2564. Escherichia coli UMEA 3199-1 tRNA-Leu
  2565. Escherichia coli UMEA 3200-1 tRNA-Leu
  2566. Escherichia coli UMEA 3201-1 tRNA-Leu
  2567. Escherichia coli UMEA 3203-1 tRNA-Leu
  2568. Escherichia coli UMEA 3206-1 tRNA-Leu
  2569. Escherichia coli UMEA 3208-1 tRNA-Leu
  2570. Escherichia coli UMEA 3212-1 tRNA-Leu
  2571. Escherichia coli UMEA 3215-1 tRNA-Leu
  2572. Escherichia coli UMEA 3216-1 tRNA-Leu
  2573. Escherichia coli UMEA 3217-1 tRNA-Leu
  2574. Escherichia coli UMEA 3220-1 tRNA-Leu
  2575. Escherichia coli UMEA 3221-1 tRNA-Leu
  2576. Escherichia coli UMEA 3222-1 tRNA-Leu
  2577. Escherichia coli UMEA 3230-1 tRNA-Leu
  2578. Escherichia coli UMEA 3233-1 tRNA-Leu
  2579. Escherichia coli UMEA 3240-1 tRNA-Leu
  2580. Escherichia coli UMEA 3244-1 tRNA-Leu
  2581. Escherichia coli UMEA 3252-1 tRNA-Leu
  2582. Escherichia coli UMEA 3257-1 tRNA-Leu
  2583. Escherichia coli UMEA 3264-1 tRNA-Leu
  2584. Escherichia coli UMEA 3268-1 tRNA-Leu
  2585. Escherichia coli UMEA 3271-1 tRNA-Leu
  2586. Escherichia coli UMEA 3290-1 tRNA-Leu
  2587. Escherichia coli UMEA 3292-1 tRNA-Leu
  2588. Escherichia coli UMEA 3298-1 tRNA-Leu
  2589. Escherichia coli UMEA 3304-1 tRNA-Leu
  2590. Escherichia coli UMEA 3314-1 tRNA-Leu
  2591. Escherichia coli UMEA 3317-1 tRNA-Leu
  2592. Escherichia coli UMEA 3318-1 tRNA-Leu
  2593. Escherichia coli UMEA 3323-1 tRNA-Leu
  2594. Escherichia coli UMEA 3329-1 tRNA-Leu
  2595. Escherichia coli UMEA 3336-1 tRNA-Leu
  2596. Escherichia coli UMEA 3337-1 tRNA-Leu
  2597. Escherichia coli UMEA 3341-1 tRNA-Leu
  2598. Escherichia coli UMEA 3342-1 tRNA-Leu
  2599. Escherichia coli UMEA 3355-1 tRNA-Leu
  2600. Escherichia coli UMEA 3391-1 tRNA-Leu
  2601. Escherichia coli UMEA 3426-1 tRNA-Leu
  2602. Escherichia coli UMEA 3490-1 tRNA-Leu
  2603. Escherichia coli UMEA 3585-1 tRNA-Leu
  2604. Escherichia coli UMEA 3592-1 tRNA-Leu
  2605. Escherichia coli UMEA 3609-1 tRNA-Leu
  2606. Escherichia coli UMEA 3617-1 tRNA-Leu
  2607. Escherichia coli UMEA 3632-1 tRNA-Leu
  2608. Escherichia coli UMEA 3652-1 tRNA-Leu
  2609. Escherichia coli UMEA 3656-1 tRNA-Leu
  2610. Escherichia coli UMEA 3662-1 tRNA-Leu
  2611. Escherichia coli UMEA 3671-1 tRNA-Leu
  2612. Escherichia coli UMEA 3682-1 tRNA-Leu
  2613. Escherichia coli UMEA 3687-1 tRNA-Leu
  2614. Escherichia coli UMEA 3693-1 tRNA-Leu
  2615. Escherichia coli UMEA 3694-1 tRNA-Leu
  2616. Escherichia coli UMEA 3702-1 tRNA-Leu
  2617. Escherichia coli UMEA 3703-1 tRNA-Leu
  2618. Escherichia coli UMEA 3705-1 tRNA-Leu
  2619. Escherichia coli UMEA 3707-1 tRNA-Leu
  2620. Escherichia coli UMEA 3718-1 tRNA-Leu
  2621. Escherichia coli UMEA 3805-1 tRNA-Leu
  2622. Escherichia coli UMEA 3821-1 tRNA-Leu
  2623. Escherichia coli UMEA 3834-1 tRNA-Leu
  2624. Escherichia coli UMEA 3889-1 tRNA-Leu
  2625. Escherichia coli UMEA 3893-1 tRNA-Leu
  2626. Escherichia coli UMEA 3899-1 tRNA-Leu
  2627. Escherichia coli UMEA 3955-1 tRNA-Leu
  2628. Escherichia coli UMEA 4075-1 tRNA-Leu
  2629. Escherichia coli UMEA 4076-1 tRNA-Leu
  2630. Escherichia coli UMEA 4207-1 tRNA-Leu
  2631. Escherichia coli UMN026 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2632. Escherichia coli UMNF18 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2633. Escherichia coli UMNK88 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2634. Escherichia coli UTI89 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2635. Escherichia coli VL2732 tRNA-Leu
  2636. Escherichia coli VL2874 tRNA-Leu
  2637. Escherichia coli VR50 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2638. Escherichia coli W26 tRNA-Leu
  2639. Escherichia coli W tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2640. Escherichia coli XH001 tRNA-Leu
  2641. Escherichia coli XH140A tRNA-Leu
  2642. Escherichia coli Xuzhou21 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2643. Escherichia fergusonii ATCC 35469 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2644. Escherichia fergusonii B253 tRNA-Leu
  2645. Escherichia fergusonii tRNA-Leu
  2646. Escherichia marmotae tRNA-Leu
  2647. Escherichia ruysiae tRNA-Leu
  2648. Escherichia sp. 0.2392 tRNA-Leu
  2649. Escherichia sp. 11.1596 tRNA-Leu
  2650. Escherichia sp. 11.1597 tRNA-Leu
  2651. Escherichia sp. 11.1600 tRNA-Leu
  2652. Escherichia sp. 1_1_43 tRNA-Leu
  2653. Escherichia sp. 12.2610 tRNA-Leu
  2654. Escherichia sp. 12.2612 tRNA-Leu
  2655. Escherichia sp. 14.0982 tRNA-Leu
  2656. Escherichia sp. 14.0985 tRNA-Leu
  2657. Escherichia sp. 14.0993 tRNA-Leu
  2658. Escherichia sp. 20412-1 tRNA-Leu
  2659. Escherichia sp. 4_1_40B tRNA-Leu
  2660. Escherichia sp. 4726-5 tRNA-Leu
  2661. Escherichia sp. 79.0191 tRNA-Leu
  2662. Escherichia sp. 8.2195 tRNA-Leu
  2663. Escherichia sp. 92.1228 tRNA-Leu
  2664. Escherichia sp. 93.0724 tRNA-Leu
  2665. Escherichia sp. 93.0743 tRNA-Leu
  2666. Escherichia sp. 93.0750 tRNA-Leu
  2667. Escherichia sp. 93.0816 tRNA-Leu
  2668. Escherichia sp. 93.1447 tRNA-Leu
  2669. Escherichia sp. 93.1462 tRNA-Leu
  2670. Escherichia sp. 93.1518 tRNA-Leu
  2671. Escherichia sp. 94.0001 tRNA-Leu
  2672. Escherichia sp. E10V10 tRNA-Leu
  2673. Escherichia sp. E10V4 tRNA-Leu
  2674. Escherichia sp. E10V5 tRNA-Leu
  2675. Escherichia sp. E1130 tRNA-Leu
  2676. Escherichia sp. E13S3 tRNA-Leu
  2677. Escherichia sp. E14S1 tRNA-Leu
  2678. Escherichia sp. E14V10 tRNA-Leu
  2679. Escherichia sp. E14V5 tRNA-Leu
  2680. Escherichia sp. E14V7 tRNA-Leu
  2681. Escherichia sp. E1S7 tRNA-Leu
  2682. Escherichia sp. E1V33 tRNA-Leu
  2683. Escherichia sp. E2562 tRNA-Leu
  2684. Escherichia sp. E2586 tRNA-Leu
  2685. Escherichia sp. E2593 tRNA-Leu
  2686. Escherichia sp. E2748 tRNA-Leu
  2687. Escherichia sp. E3356 tRNA-Leu
  2688. Escherichia sp. E3659 tRNA-Leu
  2689. Escherichia sp. E4385 tRNA-Leu
  2690. Escherichia sp. E4694 tRNA-Leu
  2691. Escherichia sp. E4736 tRNA-Leu
  2692. Escherichia sp. E4742 tRNA-Leu
  2693. Escherichia sp. Gen1 tRNA-Leu
  2694. Escherichia sp. HH26CH tRNA-Leu
  2695. Escherichia sp. HH41S tRNA-Leu
  2696. Escherichia sp. JL983 tRNA-Leu
  2697. Escherichia sp. KCJ4928 tRNA-Leu
  2698. Escherichia sp. KCJ4943 tRNA-Leu
  2699. Escherichia sp. KTE114 tRNA-Leu
  2700. Escherichia sp. KTE11 tRNA-Leu
  2701. Escherichia sp. KTE159 tRNA-Leu
  2702. Escherichia sp. KTE172 tRNA-Leu
  2703. Escherichia sp. KTE31 tRNA-Leu
  2704. Escherichia sp. KTE52 tRNA-Leu
  2705. Escherichia sp. KTE96 tRNA-Leu
  2706. Escherichia hominis tRNA-Leu
  2707. Escherichia sp. MOD1-EC5451 tRNA-Leu
  2708. Escherichia sp. MOD1-EC6475 tRNA-Leu
  2709. Escherichia sp. MR tRNA-Leu
  2710. Escherichia sp. NIC32-2 tRNA-Leu
  2711. Escherichia sp. NT45 tRNA-Leu
  2712. Escherichia sp. R8 tRNA-Leu
  2713. Escherichia sp. S2_ASV_4 tRNA-Leu
  2714. Escherichia sp. S69_ASV_4 tRNA-Leu
  2715. Escherichia sp. S85_ASV_4 tRNA-Leu
  2716. Escherichia whittamii tRNA-Leu
  2717. Escherichia sp. SCLE84 tRNA-Leu
  2718. Escherichia sp. TC-EC600-tetX4 tRNA-Leu
  2719. Escherichia sp. TM-G17TGC tRNA-Leu
  2720. Escherichia sp. tRNA-Leu
  2721. Franconibacter daqui tRNA-Leu
  2722. Franconibacter helveticus tRNA-Leu
  2723. Franconibacter pulveris tRNA-Leu
  2724. Gibbsiella quercinecans tRNA-Leu
  2725. Hafnia alvei tRNA-Leu
  2726. Izhakiella australiensis tRNA-Leu
  2727. Jejubacter calystegiae tRNA-Leu
  2728. Klebsiella aerogenes EA1509E tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2729. Klebsiella aerogenes KCTC 2190 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2730. Klebsiella aerogenes MGH 61 tRNA-Leu
  2731. Klebsiella aerogenes MGH 62 tRNA-Leu
  2732. Klebsiella aerogenes MGH 77 tRNA-Leu
  2733. Klebsiella aerogenes MGH 78 tRNA-Leu
  2734. Klebsiella aerogenes tRNA-Leu(caa)
  2735. Klebsiella aerogenes UCI 15 tRNA-Leu
  2736. Klebsiella aerogenes UCI 16 tRNA-Leu
  2737. Klebsiella aerogenes UCI 27 tRNA-Leu
  2738. Klebsiella aerogenes UCI 28 tRNA-Leu
  2739. Klebsiella aerogenes UCI 45 tRNA-Leu
  2740. Klebsiella aerogenes UCI 46 tRNA-Leu
  2741. Klebsiella aerogenes UCI 47 tRNA-Leu
  2742. Klebsiella aerogenes UCI 48 tRNA-Leu
  2743. Klebsiella africana tRNA-Leu
  2744. Klebsiella oxytoca tRNA-Leu
  2745. Klebsiella pneumoniae 120_1020 tRNA-Leu
  2746. Klebsiella pneumoniae 140_1040 tRNA-Leu
  2747. Klebsiella pneumoniae 160_1080 tRNA-Leu
  2748. Klebsiella pneumoniae 280_1220 tRNA-Leu
  2749. Klebsiella pneumoniae 303K tRNA-Leu
  2750. Klebsiella pneumoniae 30660/NJST258_1 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2751. Klebsiella pneumoniae 30684/NJST258_2 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2752. Klebsiella pneumoniae 361_1301 tRNA-Leu
  2753. Klebsiella pneumoniae 440_1540 tRNA-Leu
  2754. Klebsiella pneumoniae 500_1420 tRNA-Leu
  2755. Klebsiella pneumoniae 540_1460 tRNA-Leu
  2756. Klebsiella pneumoniae 646_1568 tRNA-Leu
  2757. Klebsiella pneumoniae 909957 tRNA-Leu
  2758. Klebsiella pneumoniae ATCC BAA-1705 tRNA-Leu
  2759. Klebsiella pneumoniae ATCC BAA-2146 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2760. Klebsiella pneumoniae BIDMC 10 tRNA-Leu
  2761. Klebsiella pneumoniae BIDMC 11 tRNA-Leu
  2762. Klebsiella pneumoniae BIDMC 12A tRNA-Leu
  2763. Klebsiella pneumoniae BIDMC 12B tRNA-Leu
  2764. Klebsiella pneumoniae BIDMC 12C tRNA-Leu
  2765. Klebsiella pneumoniae BIDMC 13 tRNA-Leu
  2766. Klebsiella pneumoniae BIDMC 14 tRNA-Leu
  2767. Klebsiella pneumoniae BIDMC 16 tRNA-Leu
  2768. Klebsiella pneumoniae BIDMC 18A tRNA-Leu
  2769. Klebsiella pneumoniae BIDMC 18B tRNA-Leu
  2770. Klebsiella pneumoniae BIDMC 18C tRNA-Leu
  2771. Klebsiella pneumoniae BIDMC 18D tRNA-Leu
  2772. Klebsiella pneumoniae BIDMC 1 tRNA-Leu
  2773. Klebsiella pneumoniae BIDMC 21 tRNA-Leu
  2774. Klebsiella pneumoniae BIDMC 22 tRNA-Leu
  2775. Klebsiella pneumoniae BIDMC 23 tRNA-Leu
  2776. Klebsiella pneumoniae BIDMC 24 tRNA-Leu
  2777. Klebsiella pneumoniae BIDMC 25 tRNA-Leu
  2778. Klebsiella pneumoniae BIDMC 2A tRNA-Leu
  2779. Klebsiella pneumoniae BIDMC 31 tRNA-Leu
  2780. Klebsiella pneumoniae BIDMC 32 tRNA-Leu
  2781. Klebsiella pneumoniae BIDMC 33B tRNA-Leu
  2782. Klebsiella pneumoniae BIDMC 34 tRNA-Leu
  2783. Klebsiella pneumoniae BIDMC 35 tRNA-Leu
  2784. Klebsiella pneumoniae BIDMC 36 tRNA-Leu
  2785. Klebsiella pneumoniae BIDMC 40 tRNA-Leu
  2786. Klebsiella pneumoniae BIDMC 41 tRNA-Leu
  2787. Klebsiella pneumoniae BIDMC 42a tRNA-Leu
  2788. Klebsiella pneumoniae BIDMC 42b tRNA-Leu
  2789. Klebsiella pneumoniae BIDMC 45 tRNA-Leu
  2790. Klebsiella pneumoniae BIDMC 46a tRNA-Leu
  2791. Klebsiella pneumoniae BIDMC 46b tRNA-Leu
  2792. Klebsiella pneumoniae BIDMC 47 tRNA-Leu
  2793. Klebsiella pneumoniae BIDMC 48 tRNA-Leu
  2794. Klebsiella pneumoniae BIDMC 4 tRNA-Leu
  2795. Klebsiella pneumoniae BIDMC 51 tRNA-Leu
  2796. Klebsiella pneumoniae BIDMC 52 tRNA-Leu
  2797. Klebsiella pneumoniae BIDMC 53 tRNA-Leu
  2798. Klebsiella pneumoniae BIDMC 54 tRNA-Leu
  2799. Klebsiella pneumoniae BIDMC 55 tRNA-Leu
  2800. Klebsiella pneumoniae BIDMC 5 tRNA-Leu
  2801. Klebsiella pneumoniae BIDMC 60 tRNA-Leu
  2802. Klebsiella pneumoniae BIDMC 68 tRNA-Leu
  2803. Klebsiella pneumoniae BIDMC 69 tRNA-Leu
  2804. Klebsiella pneumoniae BIDMC 7A tRNA-Leu
  2805. Klebsiella pneumoniae BIDMC 7B tRNA-Leu
  2806. Klebsiella pneumoniae BWH 15 tRNA-Leu
  2807. Klebsiella pneumoniae BWH 22 tRNA-Leu
  2808. Klebsiella pneumoniae BWH 28 tRNA-Leu
  2809. Klebsiella pneumoniae BWH 2 tRNA-Leu
  2810. Klebsiella pneumoniae BWH 30 tRNA-Leu
  2811. Klebsiella pneumoniae BWH 36 tRNA-Leu
  2812. Klebsiella pneumoniae BWH 41 tRNA-Leu
  2813. Klebsiella pneumoniae BWH 45 tRNA-Leu
  2814. Klebsiella pneumoniae BWH 46 tRNA-Leu
  2815. Klebsiella pneumoniae BWH 47 tRNA-Leu
  2816. Klebsiella pneumoniae BWH 48 tRNA-Leu
  2817. Klebsiella pneumoniae CG43 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2818. Klebsiella pneumoniae CHS 02 tRNA-Leu
  2819. Klebsiella pneumoniae CHS 03 tRNA-Leu
  2820. Klebsiella pneumoniae CHS 05 tRNA-Leu
  2821. Klebsiella pneumoniae CHS 06 tRNA-Leu
  2822. Klebsiella pneumoniae CHS 07 tRNA-Leu
  2823. Klebsiella pneumoniae CHS 08 tRNA-Leu
  2824. Klebsiella pneumoniae CHS 09 tRNA-Leu
  2825. Klebsiella pneumoniae CHS 11 tRNA-Leu
  2826. Klebsiella pneumoniae CHS 12 tRNA-Leu
  2827. Klebsiella pneumoniae CHS 13 tRNA-Leu
  2828. Klebsiella pneumoniae CHS 14 tRNA-Leu
  2829. Klebsiella pneumoniae CHS 16 tRNA-Leu
  2830. Klebsiella pneumoniae CHS 17 tRNA-Leu
  2831. Klebsiella pneumoniae CHS 18 tRNA-Leu
  2832. Klebsiella pneumoniae CHS 19 tRNA-Leu
  2833. Klebsiella pneumoniae CHS 20 tRNA-Leu
  2834. Klebsiella pneumoniae CHS 21 tRNA-Leu
  2835. Klebsiella pneumoniae CHS 22 tRNA-Leu
  2836. Klebsiella pneumoniae CHS 23 tRNA-Leu
  2837. Klebsiella pneumoniae CHS 24 tRNA-Leu
  2838. Klebsiella pneumoniae CHS 25 tRNA-Leu
  2839. Klebsiella pneumoniae CHS 26 tRNA-Leu
  2840. Klebsiella pneumoniae CHS 27 tRNA-Leu
  2841. Klebsiella pneumoniae CHS 28 tRNA-Leu
  2842. Klebsiella pneumoniae CHS 29 tRNA-Leu
  2843. Klebsiella pneumoniae CHS 30 tRNA-Leu
  2844. Klebsiella pneumoniae CHS 31 tRNA-Leu
  2845. Klebsiella pneumoniae CHS 32 tRNA-Leu
  2846. Klebsiella pneumoniae CHS 33 tRNA-Leu
  2847. Klebsiella pneumoniae CHS 34 tRNA-Leu
  2848. Klebsiella pneumoniae CHS 35 tRNA-Leu
  2849. Klebsiella pneumoniae CHS 36 tRNA-Leu
  2850. Klebsiella pneumoniae CHS 37 tRNA-Leu
  2851. Klebsiella pneumoniae CHS 38 tRNA-Leu
  2852. Klebsiella pneumoniae CHS 39 tRNA-Leu
  2853. Klebsiella pneumoniae CHS 40 tRNA-Leu
  2854. Klebsiella pneumoniae CHS 41 tRNA-Leu
  2855. Klebsiella pneumoniae CHS 42 tRNA-Leu
  2856. Klebsiella pneumoniae CHS 43 tRNA-Leu
  2857. Klebsiella pneumoniae CHS 44 tRNA-Leu
  2858. Klebsiella pneumoniae CHS 45 tRNA-Leu
  2859. Klebsiella pneumoniae CHS 46 tRNA-Leu
  2860. Klebsiella pneumoniae CHS 47 tRNA-Leu
  2861. Klebsiella pneumoniae CHS 48 tRNA-Leu
  2862. Klebsiella pneumoniae CHS 49 tRNA-Leu
  2863. Klebsiella pneumoniae CHS 50 tRNA-Leu
  2864. Klebsiella pneumoniae CHS 51 tRNA-Leu
  2865. Klebsiella pneumoniae CHS 52 tRNA-Leu
  2866. Klebsiella pneumoniae CHS 53 tRNA-Leu
  2867. Klebsiella pneumoniae CHS 54 tRNA-Leu
  2868. Klebsiella pneumoniae CHS 55 tRNA-Leu
  2869. Klebsiella pneumoniae CHS 56 tRNA-Leu
  2870. Klebsiella pneumoniae CHS 57 tRNA-Leu
  2871. Klebsiella pneumoniae CHS 58 tRNA-Leu
  2872. Klebsiella pneumoniae CHS 59 tRNA-Leu
  2873. Klebsiella pneumoniae CHS 60 tRNA-Leu
  2874. Klebsiella pneumoniae CHS 61 tRNA-Leu
  2875. Klebsiella pneumoniae CHS 62 tRNA-Leu
  2876. Klebsiella pneumoniae CHS 63 tRNA-Leu
  2877. Klebsiella pneumoniae CHS 64 tRNA-Leu
  2878. Klebsiella pneumoniae CHS 65 tRNA-Leu
  2879. Klebsiella pneumoniae CHS 66 tRNA-Leu
  2880. Klebsiella pneumoniae CHS 67 tRNA-Leu
  2881. Klebsiella pneumoniae CHS 70 tRNA-Leu
  2882. Klebsiella pneumoniae CHS 71 tRNA-Leu
  2883. Klebsiella pneumoniae CHS 72 tRNA-Leu
  2884. Klebsiella pneumoniae CHS 73 tRNA-Leu
  2885. Klebsiella pneumoniae CHS 74 tRNA-Leu
  2886. Klebsiella pneumoniae CHS 75 tRNA-Leu
  2887. Klebsiella pneumoniae CHS 76 tRNA-Leu
  2888. Klebsiella pneumoniae CHS 80 tRNA-Leu
  2889. Klebsiella pneumoniae DMC0526 tRNA-Leu
  2890. Klebsiella pneumoniae DMC0799 tRNA-Leu
  2891. Klebsiella pneumoniae DMC1097 tRNA-Leu
  2892. Klebsiella pneumoniae DMC1316 tRNA-Leu
  2893. Klebsiella pneumoniae HE12 tRNA-Leu
  2894. Klebsiella pneumoniae HK787 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2895. Klebsiella pneumoniae hvKP1 tRNA-Leu
  2896. Klebsiella pneumoniae JHCK1 tRNA-Leu
  2897. Klebsiella pneumoniae JM45 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2898. Klebsiella pneumoniae Kb140 tRNA-Leu
  2899. Klebsiella pneumoniae Kb677 tRNA-Leu
  2900. Klebsiella pneumoniae KCTC 2242 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2901. Klebsiella pneumoniae KP-11 tRNA-Leu
  2902. Klebsiella pneumoniae KP-1 tRNA-Leu
  2903. Klebsiella pneumoniae KP-7 tRNA-Leu
  2904. Klebsiella pneumoniae MGH 18 tRNA-Leu
  2905. Klebsiella pneumoniae MGH 19 tRNA-Leu
  2906. Klebsiella pneumoniae MGH 21 tRNA-Leu
  2907. Klebsiella pneumoniae MGH 29 tRNA-Leu
  2908. Klebsiella pneumoniae MGH 30 tRNA-Leu
  2909. Klebsiella pneumoniae MGH 31 tRNA-Leu
  2910. Klebsiella pneumoniae MGH 32 tRNA-Leu
  2911. Klebsiella pneumoniae MGH 35 tRNA-Leu
  2912. Klebsiella pneumoniae MGH 36 tRNA-Leu
  2913. Klebsiella pneumoniae MGH 39 tRNA-Leu
  2914. Klebsiella pneumoniae MGH 43 tRNA-Leu
  2915. Klebsiella pneumoniae MGH 45 tRNA-Leu
  2916. Klebsiella pneumoniae MGH 46 tRNA-Leu
  2917. Klebsiella pneumoniae MGH 47 tRNA-Leu
  2918. Klebsiella pneumoniae MGH 48 tRNA-Leu
  2919. Klebsiella pneumoniae MGH 51 tRNA-Leu
  2920. Klebsiella pneumoniae MGH 52 tRNA-Leu
  2921. Klebsiella pneumoniae MGH 60 tRNA-Leu
  2922. Klebsiella pneumoniae MGH 63 tRNA-Leu
  2923. Klebsiella pneumoniae MGH 64 tRNA-Leu
  2924. Klebsiella pneumoniae MGH 65 tRNA-Leu
  2925. Klebsiella pneumoniae MGH 66 tRNA-Leu
  2926. Klebsiella pneumoniae MGH 67 tRNA-Leu
  2927. Klebsiella pneumoniae MGH 69 tRNA-Leu
  2928. Klebsiella pneumoniae MGH 70 tRNA-Leu
  2929. Klebsiella pneumoniae MGH 71 tRNA-Leu
  2930. Klebsiella pneumoniae MGH 72 tRNA-Leu
  2931. Klebsiella pneumoniae MGH 73 tRNA-Leu
  2932. Klebsiella pneumoniae MGH 74 tRNA-Leu
  2933. Klebsiella pneumoniae MGH 75 tRNA-Leu
  2934. Klebsiella pneumoniae MGH 79 tRNA-Leu
  2935. Klebsiella pneumoniae MRSN 1319 tRNA-Leu
  2936. Klebsiella pneumoniae MRSN 2404 tRNA-Leu
  2937. Klebsiella pneumoniae MRSN 3562 tRNA-Leu
  2938. Klebsiella pneumoniae MRSN 3852 tRNA-Leu
  2939. Klebsiella pneumoniae MRSN 6902 tRNA-Leu
  2940. Klebsiella pneumoniae RYC492 tRNA-Leu
  2941. Klebsiella pneumoniae subsp. ozaenae tRNA-Leu(caa)
  2942. Klebsiella pneumoniae subsp. pneumoniae 1084 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2943. Klebsiella pneumoniae subsp. pneumoniae 1158 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2944. Klebsiella pneumoniae subsp. pneumoniae ATCC 43816 tRNA-Leu
  2945. Klebsiella pneumoniae subsp. pneumoniae CIP 52.145 = B5055 tRNA-Leu
  2946. Klebsiella pneumoniae subsp. pneumoniae BJ1-GA tRNA-Leu
  2947. Klebsiella pneumoniae subsp. pneumoniae DSM 30104 = JCM 1662 = NBRC 14940 tRNA-Leu
  2948. Klebsiella pneumoniae subsp. pneumoniae HS11286 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2949. Klebsiella pneumoniae subsp. pneumoniae Kp13 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2950. Klebsiella pneumoniae subsp. pneumoniae KPNIH10 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2951. Klebsiella pneumoniae subsp. pneumoniae KPNIH11 tRNA-Leu
  2952. Klebsiella pneumoniae subsp. pneumoniae KPNIH12 tRNA-Leu
  2953. Klebsiella pneumoniae subsp. pneumoniae KPNIH14 tRNA-Leu
  2954. Klebsiella pneumoniae subsp. pneumoniae KPNIH16 tRNA-Leu
  2955. Klebsiella pneumoniae subsp. pneumoniae KPNIH17 tRNA-Leu
  2956. Klebsiella pneumoniae subsp. pneumoniae KPNIH18 tRNA-Leu
  2957. Klebsiella pneumoniae subsp. pneumoniae KPNIH19 tRNA-Leu
  2958. Klebsiella pneumoniae subsp. pneumoniae KPNIH1 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2959. Klebsiella pneumoniae subsp. pneumoniae KPNIH20 tRNA-Leu
  2960. Klebsiella pneumoniae subsp. pneumoniae KPNIH21 tRNA-Leu
  2961. Klebsiella pneumoniae subsp. pneumoniae KPNIH22 tRNA-Leu
  2962. Klebsiella pneumoniae subsp. pneumoniae KPNIH23 tRNA-Leu
  2963. Klebsiella pneumoniae subsp. pneumoniae KPNIH24 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2964. Klebsiella pneumoniae subsp. pneumoniae KPNIH27 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2965. Klebsiella pneumoniae subsp. pneumoniae KPNIH2 tRNA-Leu
  2966. Klebsiella pneumoniae subsp. pneumoniae KPNIH4 tRNA-Leu
  2967. Klebsiella pneumoniae subsp. pneumoniae KPNIH5 tRNA-Leu
  2968. Klebsiella pneumoniae subsp. pneumoniae KPNIH6 tRNA-Leu
  2969. Klebsiella pneumoniae subsp. pneumoniae KPNIH7 tRNA-Leu
  2970. Klebsiella pneumoniae subsp. pneumoniae KPNIH8 tRNA-Leu
  2971. Klebsiella pneumoniae subsp. pneumoniae KPNIH9 tRNA-Leu
  2972. Klebsiella pneumoniae subsp. pneumoniae KpO3210 tRNA-Leu
  2973. Klebsiella pneumoniae subsp. pneumoniae KPR0928 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2974. Klebsiella pneumoniae subsp. pneumoniae MGH 78578 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2975. Klebsiella pneumoniae subsp. pneumoniae MP14 tRNA-Leu
  2976. Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2977. Klebsiella pneumoniae subsp. pneumoniae PittNDM01 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2978. Klebsiella pneumoniae subsp. pneumoniae SA1 tRNA-Leu
  2979. Klebsiella pneumoniae subsp. pneumoniae ST258-K26BO tRNA-Leu-CAA
  2980. Klebsiella pneumoniae subsp. pneumoniae T69 tRNA-Leu
  2981. Klebsiella pneumoniae subsp. pneumoniae tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2982. Klebsiella pneumoniae subsp. pneumoniae UKKV901664 tRNA-Leu
  2983. Klebsiella pneumoniae subsp. pneumoniae WGLW1 tRNA-Leu
  2984. Klebsiella pneumoniae subsp. pneumoniae WGLW2 tRNA-Leu
  2985. Klebsiella pneumoniae subsp. pneumoniae WGLW3 tRNA-Leu
  2986. Klebsiella pneumoniae subsp. pneumoniae WGLW5 tRNA-Leu
  2987. Klebsiella pneumoniae subsp. rhinoscleromatis ATCC 13884 tRNA-Leu
  2988. Klebsiella pneumoniae subsp. rhinoscleromatis SB3432 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2989. Klebsiella pneumoniae subsp. rhinoscleromatis tRNA-Leu(caa)
  2990. Klebsiella pneumoniae tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  2991. Klebsiella pneumoniae U-0608239 tRNA-Leu
  2992. Klebsiella pneumoniae UCI 17 tRNA-Leu
  2993. Klebsiella pneumoniae UCI 19 tRNA-Leu
  2994. Klebsiella pneumoniae UCI 20 tRNA-Leu
  2995. Klebsiella pneumoniae UCI 21 tRNA-Leu
  2996. Klebsiella pneumoniae UCI 22 tRNA-Leu
  2997. Klebsiella pneumoniae UCI 25 tRNA-Leu
  2998. Klebsiella pneumoniae UCI 26 tRNA-Leu
  2999. Klebsiella pneumoniae UCI 33 tRNA-Leu
  3000. Klebsiella pneumoniae UCI 34 tRNA-Leu
  3001. Klebsiella pneumoniae UCI 37 tRNA-Leu
  3002. Klebsiella pneumoniae UCI 38 tRNA-Leu
  3003. Klebsiella pneumoniae UCI 41 tRNA-Leu
  3004. Klebsiella pneumoniae UCI 42 tRNA-Leu
  3005. Klebsiella pneumoniae UCI 43 tRNA-Leu
  3006. Klebsiella pneumoniae UCI 44 tRNA-Leu
  3007. Klebsiella pneumoniae UCI 55 tRNA-Leu
  3008. Klebsiella pneumoniae UCI 56 tRNA-Leu
  3009. Klebsiella pneumoniae UCI 59 tRNA-Leu
  3010. Klebsiella pneumoniae UCI 60 tRNA-Leu
  3011. Klebsiella pneumoniae UCI 61 tRNA-Leu
  3012. Klebsiella pneumoniae UCI 62 tRNA-Leu
  3013. Klebsiella pneumoniae UCI 63 tRNA-Leu
  3014. Klebsiella pneumoniae UCI 64 tRNA-Leu
  3015. Klebsiella pneumoniae UCI 67 tRNA-Leu
  3016. Klebsiella pneumoniae UCI 68 tRNA-Leu
  3017. Klebsiella pneumoniae UCICRE 13 tRNA-Leu
  3018. Klebsiella pneumoniae UCICRE 1 tRNA-Leu
  3019. Klebsiella pneumoniae UCICRE 2 tRNA-Leu
  3020. Klebsiella pneumoniae UCICRE 4 tRNA-Leu
  3021. Klebsiella pneumoniae UCICRE 6 tRNA-Leu
  3022. Klebsiella pneumoniae UCICRE 7 tRNA-Leu
  3023. Klebsiella pneumoniae UCICRE 8 tRNA-Leu
  3024. Klebsiella pneumoniae UHKPC01 tRNA-Leu
  3025. Klebsiella pneumoniae UHKPC02 tRNA-Leu
  3026. Klebsiella pneumoniae UHKPC04 tRNA-Leu
  3027. Klebsiella pneumoniae UHKPC05 tRNA-Leu
  3028. Klebsiella pneumoniae UHKPC06 tRNA-Leu
  3029. Klebsiella pneumoniae UHKPC07 tRNA-Leu
  3030. Klebsiella pneumoniae UHKPC09 tRNA-Leu
  3031. Klebsiella pneumoniae UHKPC179 tRNA-Leu
  3032. Klebsiella pneumoniae UHKPC17 tRNA-Leu
  3033. Klebsiella pneumoniae UHKPC18 tRNA-Leu
  3034. Klebsiella pneumoniae UHKPC22 tRNA-Leu
  3035. Klebsiella pneumoniae UHKPC23 tRNA-Leu
  3036. Klebsiella pneumoniae UHKPC24 tRNA-Leu
  3037. Klebsiella pneumoniae UHKPC26 tRNA-Leu
  3038. Klebsiella pneumoniae UHKPC27 tRNA-Leu
  3039. Klebsiella pneumoniae UHKPC28 tRNA-Leu
  3040. Klebsiella pneumoniae UHKPC29 tRNA-Leu
  3041. Klebsiella pneumoniae UHKPC31 tRNA-Leu
  3042. Klebsiella pneumoniae UHKPC32 tRNA-Leu
  3043. Klebsiella pneumoniae UHKPC33 tRNA-Leu
  3044. Klebsiella pneumoniae UHKPC40 tRNA-Leu
  3045. Klebsiella pneumoniae UHKPC45 tRNA-Leu
  3046. Klebsiella pneumoniae UHKPC47 tRNA-Leu
  3047. Klebsiella pneumoniae UHKPC48 tRNA-Leu
  3048. Klebsiella pneumoniae UHKPC 52 tRNA-Leu
  3049. Klebsiella pneumoniae UHKPC57 tRNA-Leu
  3050. Klebsiella pneumoniae UHKPC59 tRNA-Leu
  3051. Klebsiella pneumoniae UHKPC61 tRNA-Leu
  3052. Klebsiella pneumoniae UHKPC67 tRNA-Leu
  3053. Klebsiella pneumoniae UHKPC69 tRNA-Leu
  3054. Klebsiella pneumoniae UHKPC77 tRNA-Leu
  3055. Klebsiella pneumoniae UHKPC81 tRNA-Leu
  3056. Klebsiella pneumoniae UHKPC96 tRNA-Leu
  3057. Klebsiella pneumoniae VA360 tRNA-Leu
  3058. Klebsiella pneumoniae VAKPC252 tRNA-Leu
  3059. Klebsiella pneumoniae VAKPC254 tRNA-Leu
  3060. Klebsiella pneumoniae VAKPC269 tRNA-Leu
  3061. Klebsiella pneumoniae VAKPC270 tRNA-Leu
  3062. Klebsiella pneumoniae VAKPC276 tRNA-Leu
  3063. Klebsiella pneumoniae VAKPC278 tRNA-Leu
  3064. Klebsiella pneumoniae VAKPC280 tRNA-Leu
  3065. Klebsiella pneumoniae VAKPC297 tRNA-Leu
  3066. Klebsiella pneumoniae VAKPC309 tRNA-Leu
  3067. Klebsiella quasipneumoniae subsp. quasipneumoniae tRNA-Leu
  3068. Klebsiella quasipneumoniae subsp. similipneumoniae tRNA-Leu
  3069. Klebsiella quasipneumoniae tRNA-Leu(caa)
  3070. Klebsiella quasivariicola tRNA-Leu
  3071. Klebsiella sp. 141153 tRNA-Leu
  3072. Klebsiella sp. 141203 tRNA-Leu
  3073. Klebsiella sp. AA405 tRNA-Leu
  3074. Klebsiella sp. Acro-833 tRNA-Leu
  3075. Klebsiella sp. A-Nf5 tRNA-Leu
  3076. Klebsiella sp. AqSCr tRNA-Leu
  3077. Klebsiella sp. B-Nf7 tRNA-Leu
  3078. Klebsiella sp. C1-16S-Nf17 tRNA-Leu
  3079. Klebsiella sp. C-Nf10 tRNA-Leu
  3080. Klebsiella sp. D-Nf1 tRNA-Leu
  3081. Klebsiella sp. E-Nf3 tRNA-Leu
  3082. Klebsiella sp. F-Nf9 tRNA-Leu
  3083. Klebsiella sp. G2-16S-Nf13 tRNA-Leu
  3084. Klebsiella sp. GL120222-02 tRNA-Leu
  3085. Klebsiella sp. G-Nf4 tRNA-Leu
  3086. Klebsiella sp. HMSC16A12 tRNA-Leu
  3087. Klebsiella sp. HMSC16C06 tRNA-Leu
  3088. Klebsiella sp. HMSC22F09 tRNA-Leu
  3089. Klebsiella sp. HMSC25G12 tRNA-Leu
  3090. Klebsiella sp. H-Nf2 tRNA-Leu
  3091. Klebsiella sp. I-Nf8 tRNA-Leu
  3092. Klebsiella sp. J-Nf11 tRNA-Leu
  3093. Klebsiella sp. K4-130 tRNA-Leu
  3094. Klebsiella sp. K4-136 tRNA-Leu
  3095. Klebsiella sp. K4-154 tRNA-Leu
  3096. Klebsiella sp. K4-170 tRNA-Leu
  3097. Klebsiella sp. K4-172 tRNA-Leu
  3098. Klebsiella sp. K4-180 tRNA-Leu
  3099. Klebsiella sp. K4-188 tRNA-Leu
  3100. Klebsiella sp. K4-38 tRNA-Leu
  3101. Klebsiella sp. K4-41 tRNA-Leu
  3102. Klebsiella sp. K4-50 tRNA-Leu
  3103. Klebsiella sp. K4-74 tRNA-Leu
  3104. Klebsiella sp. K4 tRNA-Leu
  3105. Klebsiella sp. K5-122 tRNA-Leu
  3106. Klebsiella sp. K5-175 tRNA-Leu
  3107. Klebsiella sp. K5-204 tRNA-Leu
  3108. Klebsiella sp. K5-210 tRNA-Leu
  3109. Klebsiella sp. K5-212 tRNA-Leu
  3110. Klebsiella sp. K5-222 tRNA-Leu
  3111. Klebsiella sp. K5-229 tRNA-Leu
  3112. Klebsiella sp. K5-233 tRNA-Leu
  3113. Klebsiella sp. K5-76 tRNA-Leu
  3114. Klebsiella sp. K5 tRNA-Leu
  3115. Klebsiella sp. K6-123-1 tRNA-Leu
  3116. Klebsiella sp. K6-138.1 tRNA-Leu
  3117. Klebsiella sp. K6-148 tRNA-Leu
  3118. Klebsiella sp. K6-183 tRNA-Leu
  3119. Klebsiella sp. K6-243 tRNA-Leu
  3120. Klebsiella sp. K6-322 tRNA-Leu
  3121. Klebsiella sp. KBG1 tRNA-Leu
  3122. Klebsiella sp. K-Nf6 tRNA-Leu
  3123. Klebsiella sp. KP20-425-1 tRNA-Leu
  3124. Klebsiella sp. Kpp tRNA-Leu
  3125. Klebsiella sp. KTE92 tRNA-Leu
  3126. Klebsiella sp. LY tRNA-Leu
  3127. Klebsiella sp. MS 92-3 tRNA-Leu
  3128. Klebsiella sp. NFIX53 tRNA-Leu
  3129. Klebsiella sp. P1927 tRNA-Leu
  3130. Klebsiella sp. P1954 tRNA-Leu
  3131. Klebsiella sp. P1CD1 tRNA-Leu
  3132. Klebsiella sp. PO552 tRNA-Leu
  3133. Klebsiella sp. RC2 tRNA-Leu
  3134. Klebsiella sp. SORGH_AS 1025 tRNA-Leu
  3135. Klebsiella sp. SORGH_AS 1173 tRNA-Leu
  3136. Klebsiella sp. SORGH_AS 826 tRNA-Leu
  3137. Klebsiella sp. T11 tRNA-Leu
  3138. Klebsiella sp. TF21-TM tRNA-Leu
  3139. Klebsiella indica tRNA-Leu
  3140. Klebsiella sp. tRNA-Leu
  3141. Klebsiella sp. X1-16S-Nf21 tRNA-Leu
  3142. Klebsiella sp. Z2 tRNA-Leu
  3143. Klebsiella variicola At-22 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3144. Klebsiella variicola BIDMC 61 tRNA-Leu
  3145. Klebsiella variicola CAG:634 transfer RNA-Leu(CAA)
  3146. Klebsiella variicola MGH 68 tRNA-Leu
  3147. Klebsiella variicola MGH 76 tRNA-Leu
  3148. Klebsiella variicola MGH 80 tRNA-Leu
  3149. Klebsiella variicola subsp. tropica tRNA-Leu
  3150. Klebsiella variicola subsp. variicola tRNA-Leu
  3151. Klebsiella variicola tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3152. Klebsiella variicola UCI 18 tRNA-Leu
  3153. Kluyvera intermedia tRNA-Leu(caa)
  3154. [Kluyvera] intestini tRNA-Leu
  3155. Kluyvera sp. Nf5 tRNA-Leu
  3156. Kosakonia oryzae tRNA-Leu
  3157. Kosakonia oryzendophytica tRNA-Leu
  3158. Kosakonia oryziphila tRNA_Leu_CAA
  3159. Kosakonia pseudosacchari tRNA-Leu
  3160. Kosakonia radicincitans DSM 16656 tRNA-Leu
  3161. Kosakonia radicincitans tRNA-Leu
  3162. Kosakonia radicincitans UMEnt01/12 tRNA-Leu
  3163. Kosakonia radicincitans YD4 tRNA-Leu
  3164. Kosakonia sacchari SP1 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3165. Kosakonia sacchari tRNA-Leu
  3166. Kosakonia sp. H02 tRNA-Leu
  3167. Kosakonia sp. H7A tRNA-Leu
  3168. Kosakonia sp. MH5 tRNA-Leu
  3169. Kosakonia sp. ML.JS2a tRNA-Leu
  3170. Kosakonia sp. MUSA4 tRNA-Leu
  3171. Kosakonia sp. SOY2 tRNA-Leu
  3172. Kosakonia quasisacchari tRNA-Leu
  3173. Lactiplantibacillus mudanjiangensis tRNA-Leu(caa)
  3174. Lactococcus lactis (human gut metagenome) tRNA-Leu
  3175. Leclercia adecarboxylata ATCC 23216 = NBRC 102595 tRNA-Leu
  3176. Leclercia adecarboxylata (uncultured bacterium metagenome) tRNA-Leu
  3177. Leclercia sp. 119287 tRNA-Leu
  3178. Leclercia sp. 29361 tRNA-Leu
  3179. Leclercia pneumoniae tRNA-Leu
  3180. Leclercia sp. Colony189 tRNA-Leu
  3181. Leclercia sp. EMC7 tRNA-Leu
  3182. Leclercia sp. J807 tRNA-Leu
  3183. Leclercia sp. LK8 tRNA-Leu
  3184. Leclercia sp. LSNIH6 tRNA-Leu
  3185. Leclercia sp. LSNIH7 tRNA-Leu
  3186. Leclercia sp. LSNIH8 tRNA-Leu
  3187. Leclercia sp. W17 tRNA-Leu
  3188. Leclercia sp. W6 tRNA-Leu
  3189. Leclercia tamurae tRNA-Leu
  3190. Lelliottia amnigena CHS 78 tRNA-Leu
  3191. Lelliottia amnigena tRNA-Leu(caa)
  3192. Lelliottia aquatilis tRNA-Leu
  3193. Lelliottia nimipressuralis tRNA-Leu
  3194. Lelliottia sp. 7254-16 tRNA-Leu
  3195. Lelliottia sp. F153 tRNA-Leu
  3196. Lelliottia sp. F154 tRNA-Leu
  3197. Lelliottia sp. F159 tRNA-Leu
  3198. Lelliottia sp. SL45 tRNA-Leu
  3199. Lelliottia sp. T2.26D-8 tRNA-Leu(caa)
  3200. Leptospira interrogans serovar Pomona tRNA-Leu
  3201. Ligilactobacillus acidipiscis (gut metagenome) tRNA-Leu
  3202. Lonsdalea britannica tRNA-Leu
  3203. Lonsdalea iberica tRNA-Leu
  3204. Lonsdalea populi tRNA-Leu
  3205. Lonsdalea quercina tRNA-Leu
  3206. Mangrovibacter phragmitis tRNA-Leu
  3207. Mangrovibacter sp. MFB070 tRNA-Leu
  3208. Phytobacter sp. MRY16-398 tRNA-Leu
  3209. Phytobacter sp. tRNA-Leu
  3210. Mixta calida tRNA-Leu
  3211. Mixta gaviniae tRNA-Leu
  3212. Mixta intestinalis tRNA-Leu
  3213. Mixta mediterraneensis tRNA-Leu
  3214. Mixta tenebrionis tRNA-Leu
  3215. Mixta theicola tRNA-Leu
  3216. Mogibacterium sp. tRNA-Leu
  3217. Musicola paradisiaca Ech703 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3218. Pantoea agglomerans tRNA-Leu(caa)
  3219. Mixta calida B021323 tRNA-Leu
  3220. Pantoea coffeiphila tRNA-Leu
  3221. Pantoea cypripedii tRNA-Leu
  3222. Pantoea dispersa 625 tRNA-Leu
  3223. Pantoea dispersa EGD-AAK13 tRNA-Leu
  3224. Pantoea dispersa (indoor metagenome) tRNA-Leu
  3225. Pantoea phytobeneficialis tRNA-Leu
  3226. Pantoea sp. At-9b tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3227. Pantoea sp. B_10 tRNA-Leu
  3228. Pantoea sp. B270 tRNA-Leu
  3229. Pantoea sp. B_9 tRNA-Leu
  3230. Pantoea sp. ICBG 828 tRNA-Leu
  3231. Pantoea sp. ICBG 985 tRNA-Leu
  3232. [Pantoea] beijingensis tRNA-Leu
  3233. Pantoea sp. LMR881 tRNA-Leu
  3234. Pantoea sp. LS15 tRNA-Leu
  3235. Pantoea sp. Morm tRNA-Leu
  3236. Pantoea sp. Pent (symbiont metagenome) tRNA-Leu
  3237. Pantoea sp. PSNIH2 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3238. Pantoea sp. PSNIH3 tRNA-Leu
  3239. Pantoea sp. PSNIH4 tRNA-Leu
  3240. Pantoea sp. PSNIH5 tRNA-Leu
  3241. Pantoea sp. R102 tRNA-Leu
  3242. Pantoea sp. tRNA-Leu
  3243. Pantoea sp. VS1 tRNA-Leu
  3244. Pectobacterium aquaticum tRNA-Leu
  3245. Pectobacterium betavasculorum tRNA-Leu
  3246. Pectobacterium cacticida tRNA-Leu
  3247. Pectobacterium actinidiae tRNA-Leu
  3248. Pectobacterium carotovorum subsp. carotovorum tRNA-Leu
  3249. Pectobacterium carotovorum tRNA-Leu
  3250. Pectobacterium parmentieri tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3251. Pectobacterium parmentieri WPP163 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3252. Pectobacterium polonicum tRNA-Leu
  3253. Pectobacterium punjabense tRNA-Leu
  3254. Pectobacterium wasabiae CFBP 3304 tRNA-Leu
  3255. Pectobacterium wasabiae tRNA-Leu
  3256. Pectobacterium zantedeschiae tRNA-Leu
  3257. Pedobacter himalayensis tRNA-Leu
  3258. Phytobacter diazotrophicus tRNA-Leu
  3259. Phytobacter sp. tRNA-Leu
  3260. Phytobacter ursingii tRNA-Leu
  3261. Plautia stali symbiont tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3262. Plesiomonas sp. tRNA-Leu
  3263. Podoviridae sp. cti6G1 tRNA-Leu
  3264. Providencia stuartii tRNA-Leu
  3265. Pseudenterobacter timonensis tRNA-Leu
  3266. Pseudocitrobacter corydidari tRNA-Leu
  3267. Pseudocitrobacter faecalis tRNA-Leu
  3268. Pseudocitrobacter sp. 73 tRNA-Leu
  3269. Pseudocitrobacter sp. RIT 415 tRNA-Leu
  3270. Pseudocitrobacter vendiensis tRNA-Leu
  3271. Pseudomonas aeruginosa tRNA-Leu
  3272. Pseudomonas sp. SWRI144 tRNA-Leu
  3273. Pseudomonas tritici tRNA-Leu
  3274. Raoultella electrica tRNA-Leu
  3275. Raoultella ornithinolytica 10-5246 tRNA-Leu
  3276. Raoultella ornithinolytica 2-156-04_S1_C1 tRNA-Leu
  3277. Raoultella ornithinolytica 2-156-04_S1_C2 tRNA-Leu
  3278. Raoultella ornithinolytica B6 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3279. Raoultella ornithinolytica CD1_MRS_4 tRNA-Leu
  3280. Raoultella ornithinolytica tRNA-Leu
  3281. Raoultella planticola ATCC 33531 tRNA-Leu
  3282. Raoultella planticola tRNA-Leu
  3283. Raoultella sp. Lac1 tRNA-Leu
  3284. Raoultella sp. Lac2 tRNA-Leu
  3285. Raoultella sp. RIT712 tRNA-Leu
  3286. Raoultella sp. RLT01 tRNA-Leu
  3287. Raoultella sp. T31 tRNA-Leu
  3288. Raoultella sp. tRNA-Leu
  3289. Raoultella sp. X13 tRNA-Leu
  3290. Raoultella sp. XY-1 tRNA-Leu
  3291. Salmonella bongori CFSAN000510 tRNA-Leu
  3292. Salmonella bongori N268-08 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3293. Salmonella bongori NCTC 12419 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3294. Salmonella bongori serovar 40:z35:- str. 95-0123 tRNA-Leu
  3295. Salmonella bongori serovar 40:z35:- tRNA-Leu
  3296. Salmonella bongori serovar 44:r:- tRNA-Leu
  3297. Salmonella bongori serovar 48:i:- str. 94-0708 tRNA-Leu
  3298. Salmonella bongori serovar 48:i:- tRNA-Leu
  3299. Salmonella bongori serovar 48:z35:- tRNA-Leu
  3300. Salmonella bongori serovar 48:z41:-- str. RKS3044 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3301. Salmonella bongori serovar 66:z41:- str. SA19983605 tRNA-Leu
  3302. Salmonella bongori serovar 66:z65:- tRNA-Leu
  3303. Salmonella bongori tRNA-Leu(caa)
  3304. Salmonella enterica subsp. arizonae serovar [1],13,23:g,z51:- tRNA-Leu
  3305. Salmonella enterica subsp. arizonae serovar 13,22:z4,z23:- tRNA-Leu
  3306. Salmonella enterica subsp. arizonae serovar 13,23:gz51:- tRNA-Leu
  3307. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM 32450 tRNA-Leu
  3308. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM 32457 tRNA-Leu
  3309. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM 43478 tRNA-Leu
  3310. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM 43479 tRNA-Leu
  3311. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM 43480 tRNA-Leu
  3312. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM 43481 tRNA-Leu
  3313. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM 43482 tRNA-Leu
  3314. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N18383 tRNA-Leu
  3315. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N18503 tRNA-Leu
  3316. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N18554 tRNA-Leu
  3317. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N20028 tRNA-Leu
  3318. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N23850 tRNA-Leu
  3319. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N25373 tRNA-Leu
  3320. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N26624 tRNA-Leu
  3321. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N26625 tRNA-Leu
  3322. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N26626 tRNA-Leu
  3323. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N26928 tRNA-Leu
  3324. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N27 tRNA-Leu
  3325. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N29354 tRNA-Leu
  3326. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N31597 tRNA-Leu
  3327. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N4410 tRNA-Leu
  3328. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N5 tRNA-Leu
  3329. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N6509 tRNA-Leu
  3330. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N7307 tRNA-Leu
  3331. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N9135 tRNA-Leu
  3332. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- tRNA-Leu
  3333. Salmonella enterica subsp. arizonae serovar 18:z4,z32:- tRNA-Leu
  3334. Salmonella enterica subsp. arizonae serovar 21:z4,z23:- tRNA-Leu
  3335. Salmonella enterica subsp. arizonae serovar 35:z4,z32:- tRNA-Leu
  3336. Salmonella enterica subsp. arizonae serovar 38:z4,z23:- tRNA-Leu
  3337. Salmonella enterica subsp. arizonae serovar 40:z36:- tRNA-Leu
  3338. Salmonella enterica subsp. arizonae serovar 40:z4,z23:- tRNA-Leu
  3339. Salmonella enterica subsp. arizonae serovar 40:z4,z24: tRNA-Leu
  3340. Salmonella enterica subsp. arizonae serovar 41:z4,z23:- str. 01-0089 tRNA-Leu
  3341. Salmonella enterica subsp. arizonae serovar 41:z4,z23:- tRNA-Leu
  3342. Salmonella enterica subsp. arizonae serovar 41:z4,z32:- tRNA-Leu
  3343. Salmonella enterica subsp. arizonae serovar 44:z4,z23,z32:- tRNA-Leu
  3344. Salmonella enterica subsp. arizonae serovar 47:z4,z23:- tRNA-Leu
  3345. Salmonella enterica subsp. arizonae serovar 48:z4,z23:- tRNA-Leu
  3346. Salmonella enterica subsp. arizonae serovar 48:z4,z24:- tRNA-Leu
  3347. Salmonella enterica subsp. arizonae serovar 50:r:z tRNA-Leu
  3348. Salmonella enterica subsp. arizonae serovar 51:g,z51:- tRNA-Leu
  3349. Salmonella enterica subsp. arizonae serovar 53:-:- str. SA20100345 tRNA-Leu
  3350. Salmonella enterica subsp. arizonae serovar 56:z4,z23:- tRNA-Leu
  3351. Salmonella enterica subsp. arizonae serovar 62:z36:- str. 5335/86 tRNA-Leu
  3352. Salmonella enterica subsp. arizonae serovar 62:z36:- str. RKS2983 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3353. Salmonella enterica subsp. arizonae serovar 62:z36:- tRNA-Leu
  3354. Salmonella enterica subsp. arizonae serovar 62:z4,z23:- tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3355. Salmonella enterica subsp. arizonae serovar 63:g,z51:- str. So 20/20 tRNA-Leu
  3356. Salmonella enterica subsp. arizonae serovar 63:g,z51:- tRNA-Leu
  3357. Salmonella enterica subsp. arizonae str. CFSAN000560 tRNA-Leu
  3358. Salmonella enterica subsp. arizonae tRNA-Leu
  3359. Salmonella enterica subsp. diarizonae serovar 11:k:z53 tRNA-Leu
  3360. Salmonella enterica subsp. diarizonae serovar 16:z10:e,n,x,z15 tRNA-Leu
  3361. Salmonella enterica subsp. diarizonae serovar 17:z10:e,n,x,z15 tRNA-Leu
  3362. Salmonella enterica subsp. diarizonae serovar 35:k:e,n,x,z15 tRNA-Leu
  3363. Salmonella enterica subsp. diarizonae serovar 38:[k]:- tRNA-Leu
  3364. Salmonella enterica subsp. diarizonae serovar 38:[k]:z35 tRNA-Leu
  3365. Salmonella enterica subsp. diarizonae serovar 38:[k]:z35:- tRNA-Leu
  3366. Salmonella enterica subsp. diarizonae serovar 38:k:z tRNA-Leu
  3367. Salmonella enterica subsp. diarizonae serovar 47:k:z35 tRNA-Leu
  3368. Salmonella enterica subsp. diarizonae serovar 47:k:z53:[z84] tRNA-Leu
  3369. Salmonella enterica subsp. diarizonae serovar 48:i:z tRNA-Leu
  3370. Salmonella enterica subsp. diarizonae serovar 48:z52:z tRNA-Leu
  3371. Salmonella enterica subsp. diarizonae serovar 50:k:z str. MZ0080 tRNA-Leu
  3372. Salmonella enterica subsp. diarizonae serovar 50:k:z tRNA-Leu
  3373. Salmonella enterica subsp. diarizonae serovar 50:k:z:[z50],[z57],[z68], [z86] tRNA-Leu
  3374. Salmonella enterica subsp. diarizonae serovar 50:l,v:z35 tRNA-Leu
  3375. Salmonella enterica subsp. diarizonae serovar 50:r:z tRNA-Leu
  3376. Salmonella enterica subsp. diarizonae serovar 50:z:- tRNA-Leu
  3377. Salmonella enterica subsp. diarizonae serovar 50:z:z52 tRNA-Leu
  3378. Salmonella enterica subsp. diarizonae serovar 53:r:z35 tRNA-Leu
  3379. Salmonella enterica subsp. diarizonae serovar 53:z10:- tRNA-Leu
  3380. Salmonella enterica subsp. diarizonae serovar 59:[k]:z35 tRNA-Leu
  3381. Salmonella enterica subsp. diarizonae serovar 59:z10:- tRNA-Leu
  3382. Salmonella enterica subsp. diarizonae serovar 60:r:e,n,x,z15 str. 01-0170 tRNA-Leu
  3383. Salmonella enterica subsp. diarizonae serovar 60:r:e,n,x,z15 tRNA-Leu
  3384. Salmonella enterica subsp. diarizonae serovar 61:-:1,5,7 tRNA-Leu
  3385. Salmonella enterica subsp. diarizonae serovar 61:k:1,5,(7) tRNA-Leu
  3386. Salmonella enterica subsp. diarizonae serovar 61:k:1,5,7 tRNA-Leu
  3387. Salmonella enterica subsp. diarizonae serovar 61:l,v:1,5,7 tRNA-Leu
  3388. Salmonella enterica subsp. diarizonae serovar 61:l,[v],[z13]:1,5,[7] tRNA-Leu
  3389. Salmonella enterica subsp. diarizonae serovar 61:l,v:z35 tRNA-Leu
  3390. Salmonella enterica subsp. diarizonae serovar 61:r:z53 tRNA-Leu
  3391. Salmonella enterica subsp. diarizonae serovar 61:r:z tRNA-Leu
  3392. Salmonella enterica subsp. diarizonae serovar 61:z52:z53 tRNA-Leu
  3393. Salmonella enterica subsp. diarizonae serovar 65:c:z str. SA20044251 tRNA-Leu
  3394. Salmonella enterica subsp. diarizonae serovar 65:z10:e,n,x,z15 tRNA-Leu
  3395. Salmonella enterica subsp. diarizonae serovar b,50:-:- tRNA-Leu
  3396. Salmonella enterica subsp. diarizonae serovar Rough:r:z tRNA-Leu
  3397. Salmonella enterica subsp. diarizonae serovar Rough:-:- tRNA-Leu
  3398. Salmonella enterica subsp. diarizonae str. CFSAN000553 tRNA-Leu
  3399. Salmonella enterica subsp. diarizonae str. CFSAN000558 tRNA-Leu
  3400. Salmonella enterica subsp. diarizonae tRNA-Leu
  3401. Salmonella enterica subsp. enterica serovar 1,3,19:g,m,t:- tRNA-Leu
  3402. Salmonella enterica subsp. enterica serovar 13,23:b:- tRNA-Leu
  3403. Salmonella enterica subsp. enterica serovar 13,23:i:- tRNA-Leu
  3404. Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- tRNA-Leu
  3405. Salmonella enterica subsp. enterica serovar 16:b:- tRNA-Leu
  3406. Salmonella enterica subsp. enterica serovar 1,9,12:-:- tRNA-Leu
  3407. Salmonella enterica subsp. enterica serovar 3,10:e,h:- tRNA-Leu
  3408. Salmonella enterica subsp. enterica serovar 4,12:d:- tRNA-Leu
  3409. Salmonella enterica subsp. enterica serovar 4,12:i:- tRNA-Leu
  3410. Salmonella enterica subsp. enterica serovar 4,12:r:- tRNA-Leu
  3411. Salmonella enterica subsp. enterica serovar 4:-:1,2 tRNA-Leu
  3412. Salmonella enterica subsp. enterica serovar 43:a:1,7 tRNA-Leu
  3413. Salmonella enterica subsp. enterica serovar 44:z10:1,7 tRNA-Leu
  3414. Salmonella enterica subsp. enterica serovar 4,5,12,27:- tRNA-Leu
  3415. Salmonella enterica subsp. enterica serovar 4,[5],12:b:- tRNA-Leu
  3416. Salmonella enterica subsp. enterica serovar 4,5,12:b:- tRNA-Leu
  3417. Salmonella enterica subsp. enterica serovar 4,[5],12:d:- tRNA-Leu
  3418. Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. 08-1700 tRNA-Leu
  3419. Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. 08-1736 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3420. Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. 08-1739 tRNA-Leu
  3421. Salmonella enterica subsp. enterica serovar 4,[5],12:i:- tRNA-Leu
  3422. Salmonella enterica subsp. enterica serovar 4,[5],12:i:- tRNA-Leu
  3423. Salmonella enterica subsp. enterica serovar 4,5,12:i tRNA-Leu
  3424. Salmonella enterica subsp. enterica serovar 4,5,12:i:- tRNA-Leu
  3425. Salmonella enterica subsp. enterica serovar 4,[5],12:r:- tRNA-Leu
  3426. Salmonella enterica subsp. enterica serovar 4,[5],12:- tRNA-Leu
  3427. Salmonella enterica subsp. enterica serovar 4:i:- tRNA-Leu
  3428. Salmonella enterica subsp. enterica serovar [5],12,[27]:d:- tRNA-Leu
  3429. Salmonella enterica subsp. enterica serovar 51:z:1,5 tRNA-Leu
  3430. Salmonella enterica subsp. enterica serovar 6,7,[14]:-:1,5 tRNA-Leu
  3431. Salmonella enterica subsp. enterica serovar 6,7,14:g,m[p],s:[1,2,7] tRNA-Leu
  3432. Salmonella enterica subsp. enterica serovar 6,7:-:1,5 tRNA-Leu
  3433. Salmonella enterica subsp. enterica serovar 6,7:-1,5 tRNA-Leu
  3434. Salmonella enterica subsp. enterica serovar 6,7:b:- tRNA-Leu
  3435. Salmonella enterica subsp. enterica serovar 6,7:c:1,5 tRNA-Leu
  3436. Salmonella enterica subsp. enterica serovar 6,7:e,h:- tRNA-Leu
  3437. Salmonella enterica subsp. enterica serovar 6,7:k:- tRNA-Leu
  3438. Salmonella enterica subsp. enterica serovar 6,7:l,v:- tRNA-Leu
  3439. Salmonella enterica subsp. enterica serovar 6,7:-:l,w tRNA-Leu
  3440. Salmonella enterica subsp. enterica serovar 6,7:-:- tRNA-Leu
  3441. Salmonella enterica subsp. enterica serovar 6,8:-:1,2 tRNA-Leu
  3442. Salmonella enterica subsp. enterica serovar 6,8,20:d- tRNA-Leu
  3443. Salmonella enterica subsp. enterica serovar 6,8:d:- tRNA-Leu
  3444. Salmonella enterica subsp. enterica serovar 6,8:i:- tRNA-Leu
  3445. Salmonella enterica subsp. enterica serovar 7:d:z35 tRNA-Leu
  3446. Salmonella enterica subsp. enterica serovar 8,(20):i:- tRNA-Leu
  3447. Salmonella enterica subsp. enterica serovar 8,(20):-:z6 tRNA-Leu
  3448. Salmonella enterica subsp. enterica serovar 9,12-:1,5 tRNA-Leu
  3449. Salmonella enterica subsp. enterica serovar 9,12:-:1,5 tRNA-Leu
  3450. Salmonella enterica subsp. enterica serovar 9,12:l,v:- str. 94293 tRNA-Leu
  3451. Salmonella enterica subsp. enterica serovar 9,12:l,z28:- tRNA-Leu
  3452. Salmonella enterica subsp. enterica serovar 9,12:- tRNA-Leu
  3453. Salmonella enterica subsp. enterica serovar 9,12:-:- tRNA-Leu
  3454. Salmonella enterica subsp. enterica serovar Abaetetuba str. ATCC 35640 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3455. Salmonella enterica subsp. enterica serovar Abaetetuba tRNA-Leu
  3456. Salmonella enterica subsp. enterica serovar Aba tRNA-Leu
  3457. Salmonella enterica subsp. enterica serovar Abeokuta tRNA-Leu
  3458. Salmonella enterica subsp. enterica serovar Aberdeen tRNA-Leu
  3459. Salmonella enterica subsp. enterica serovar Abony str. 0014 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3460. Salmonella enterica subsp. enterica serovar Abony tRNA-Leu
  3461. Salmonella enterica subsp. enterica serovar Abortusequi tRNA-Leu
  3462. Salmonella enterica subsp. enterica serovar Abortusovis tRNA-Leu
  3463. Salmonella enterica subsp. enterica serovar Adabraka tRNA-Leu
  3464. Salmonella enterica subsp. enterica serovar Adamstua tRNA-Leu
  3465. Salmonella enterica subsp. enterica serovar Adelaide str. A4-669 tRNA-Leu
  3466. Salmonella enterica subsp. enterica serovar Adelaide tRNA-Leu
  3467. Salmonella enterica subsp. enterica serovar Aderike tRNA-Leu
  3468. Salmonella enterica subsp. enterica serovar Adjame tRNA-Leu
  3469. Salmonella enterica subsp. enterica serovar Afula tRNA-Leu
  3470. Salmonella enterica subsp. enterica serovar Agama tRNA-Leu
  3471. Salmonella enterica subsp. enterica serovar Agbeni tRNA-Leu
  3472. Salmonella enterica subsp. enterica serovar Agona str. 0292 tRNA-Leu
  3473. Salmonella enterica subsp. enterica serovar Agona str. 0322 tRNA-Leu
  3474. Salmonella enterica subsp. enterica serovar Agona str. 241981 tRNA-Leu
  3475. Salmonella enterica subsp. enterica serovar Agona str. 24249 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3476. Salmonella enterica subsp. enterica serovar Agona str. 246555-3 tRNA-Leu
  3477. Salmonella enterica subsp. enterica serovar Agona str. 266757-1 tRNA-Leu
  3478. Salmonella enterica subsp. enterica serovar Agona str. 311387-1 tRNA-Leu
  3479. Salmonella enterica subsp. enterica serovar Agona str. 339787 tRNA-Leu
  3480. Salmonella enterica subsp. enterica serovar Agona str. 392869-1 tRNA-Leu
  3481. Salmonella enterica subsp. enterica serovar Agona str. 392869-2 tRNA-Leu
  3482. Salmonella enterica subsp. enterica serovar Agona str. 400095 11 tRNA-Leu
  3483. Salmonella enterica subsp. enterica serovar Agona str. 400095 13 tRNA-Leu
  3484. Salmonella enterica subsp. enterica serovar Agona str. 400095 14 tRNA-Leu
  3485. Salmonella enterica subsp. enterica serovar Agona str. 400095 17 tRNA-Leu
  3486. Salmonella enterica subsp. enterica serovar Agona str. 400095 18 tRNA-Leu
  3487. Salmonella enterica subsp. enterica serovar Agona str. 400095 19 tRNA-Leu
  3488. Salmonella enterica subsp. enterica serovar Agona str. 400095 22 tRNA-Leu
  3489. Salmonella enterica subsp. enterica serovar Agona str. 400096 16 tRNA-Leu
  3490. Salmonella enterica subsp. enterica serovar Agona str. 400100 30-11 tRNA-Leu
  3491. Salmonella enterica subsp. enterica serovar Agona str. 400100 5-3 tRNA-Leu
  3492. Salmonella enterica subsp. enterica serovar Agona str. 400100 6-5 tRNA-Leu
  3493. Salmonella enterica subsp. enterica serovar Agona str. 400100 7-9 tRNA-Leu
  3494. Salmonella enterica subsp. enterica serovar Agona str. 409753-6 tRNA-Leu
  3495. Salmonella enterica subsp. enterica serovar Agona str. 419639 2-1 tRNA-Leu
  3496. Salmonella enterica subsp. enterica serovar Agona str. 432613 tRNA-Leu
  3497. Salmonella enterica subsp. enterica serovar Agona str. 442692 2-4 tRNA-Leu
  3498. Salmonella enterica subsp. enterica serovar Agona str. 442692 2-5 tRNA-Leu
  3499. Salmonella enterica subsp. enterica serovar Agona str. 447967 1-1 tRNA-Leu
  3500. Salmonella enterica subsp. enterica serovar Agona str. 447967 2-1 tRNA-Leu
  3501. Salmonella enterica subsp. enterica serovar Agona str. 460004 1-1 tRNA-Leu
  3502. Salmonella enterica subsp. enterica serovar Agona str. 460004 2-1 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3503. Salmonella enterica subsp. enterica serovar Agona str. 467481 tRNA-Leu
  3504. Salmonella enterica subsp. enterica serovar Agona str. 557928 tRNA-Leu
  3505. Salmonella enterica subsp. enterica serovar Agona str. 620239 tRNA-Leu
  3506. Salmonella enterica subsp. enterica serovar Agona str. 632182-2 tRNA-Leu
  3507. Salmonella enterica subsp. enterica serovar Agona str. 648586-1 tRNA-Leu
  3508. Salmonella enterica subsp. enterica serovar Agona str. ATCC 51957 tRNA-Leu
  3509. Salmonella enterica subsp. enterica serovar Agona str. ATCC BAA-707 tRNA-Leu
  3510. Salmonella enterica subsp. enterica serovar Agona str. SA-1 tRNA-Leu
  3511. Salmonella enterica subsp. enterica serovar Agona str. SA-2 tRNA-Leu
  3512. Salmonella enterica subsp. enterica serovar Agona str. SA-3 tRNA-Leu
  3513. Salmonella enterica subsp. enterica serovar Agona str. SA-4 tRNA-Leu
  3514. Salmonella enterica subsp. enterica serovar Agona str. SA-5 tRNA-Leu
  3515. Salmonella enterica subsp. enterica serovar Agona str. SH08SF124 tRNA-Leu
  3516. Salmonella enterica subsp. enterica serovar Agona str. SH10GFN094 tRNA-Leu
  3517. Salmonella enterica subsp. enterica serovar Agona str. SH11G1113 tRNA-Leu
  3518. Salmonella enterica subsp. enterica serovar Agona str. SL483 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3519. Salmonella enterica subsp. enterica serovar Agona tRNA-Leu
  3520. Salmonella enterica subsp. enterica serovar Ago tRNA-Leu
  3521. Salmonella enterica subsp. enterica serovar Agoueve tRNA-Leu
  3522. Salmonella enterica subsp. enterica serovar Ahuza tRNA-Leu
  3523. Salmonella enterica subsp. enterica serovar Ajiobo tRNA-Leu
  3524. Salmonella enterica subsp. enterica serovar Akanji tRNA-Leu
  3525. Salmonella enterica subsp. enterica serovar Alabama tRNA-Leu
  3526. Salmonella enterica subsp. enterica serovar Alachua str. R6-377 tRNA-Leu
  3527. Salmonella enterica subsp. enterica serovar Alachua tRNA-Leu
  3528. Salmonella enterica subsp. enterica serovar Albany str. ATCC 51960 tRNA-Leu
  3529. Salmonella enterica subsp. enterica serovar Albany tRNA-Leu
  3530. Salmonella enterica subsp. enterica serovar Albert tRNA-Leu
  3531. Salmonella enterica subsp. enterica serovar Allandale tRNA-Leu
  3532. Salmonella enterica subsp. enterica serovar Altendorf tRNA-Leu
  3533. Salmonella enterica subsp. enterica serovar Altona tRNA-Leu
  3534. Salmonella enterica subsp. enterica serovar Amager tRNA-Leu
  3535. Salmonella enterica subsp. enterica serovar Amersfoort tRNA-Leu
  3536. Salmonella enterica subsp. enterica serovar Amoutive tRNA-Leu
  3537. Salmonella enterica subsp. enterica serovar Amsterdam tRNA-Leu
  3538. Salmonella enterica subsp. enterica serovar Amsterdam var. 15+,34+ tRNA-Leu
  3539. Salmonella enterica subsp. enterica serovar Anatum str. 0262 tRNA-Leu
  3540. Salmonella enterica subsp. enterica serovar Anatum str. ATCC BAA-1592 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3541. Salmonella enterica subsp. enterica serovar Anatum str. CDC 06-0532 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3542. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN000511 tRNA-Leu
  3543. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003961 tRNA-Leu
  3544. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003962 tRNA-Leu
  3545. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003963 tRNA-Leu
  3546. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003964 tRNA-Leu
  3547. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003967 tRNA-Leu
  3548. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003970 tRNA-Leu
  3549. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003971 tRNA-Leu
  3550. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003972 tRNA-Leu
  3551. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003973 tRNA-Leu
  3552. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003974 tRNA-Leu
  3553. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003975 tRNA-Leu
  3554. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN004002 tRNA-Leu
  3555. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN004004 tRNA-Leu
  3556. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN004005 tRNA-Leu
  3557. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN004010 tRNA-Leu
  3558. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN004011 tRNA-Leu
  3559. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN004012 tRNA-Leu
  3560. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN004013 tRNA-Leu
  3561. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN004014 tRNA-Leu
  3562. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN004015 tRNA-Leu
  3563. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN004017 tRNA-Leu
  3564. Salmonella enterica subsp. enterica serovar Anatum str. USDA 100 tRNA-Leu
  3565. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1175 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3566. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1676 tRNA-Leu
  3567. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1677 tRNA-Leu
  3568. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1727 tRNA-Leu
  3569. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1728 tRNA-Leu
  3570. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1735 tRNA-Leu
  3571. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1736 tRNA-Leu
  3572. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1765 tRNA-Leu
  3573. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1766 tRNA-Leu
  3574. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1781 tRNA-Leu
  3575. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1783 tRNA-Leu
  3576. Salmonella enterica subsp. enterica serovar Anatum tRNA-Leu
  3577. Salmonella enterica subsp. enterica serovar Anatum var. 15+ tRNA-Leu
  3578. Salmonella enterica subsp. enterica serovar Anecho tRNA-Leu
  3579. Salmonella enterica subsp. enterica serovar Anfo tRNA-Leu
  3580. Salmonella enterica subsp. enterica serovar Angoda tRNA-Leu
  3581. Salmonella enterica subsp. enterica serovar Ank tRNA-Leu
  3582. Salmonella enterica subsp. enterica serovar Antsalova str. S01-0511 tRNA-Leu
  3583. Salmonella enterica subsp. enterica serovar Antsalova tRNA-Leu
  3584. Salmonella enterica subsp. enterica serovar Apapa str. SA20060561 tRNA-Leu
  3585. Salmonella enterica subsp. enterica serovar Apapa tRNA-Leu
  3586. Salmonella enterica subsp. enterica serovar Apeyeme tRNA-Leu
  3587. Salmonella enterica subsp. enterica serovar Aqua str. NVSL2001 tRNA-Leu
  3588. Salmonella enterica subsp. enterica serovar Arechavaleta tRNA-Leu
  3589. Salmonella enterica subsp. enterica serovar Arkansas tRNA-Leu
  3590. Salmonella enterica subsp. enterica serovar Aschersleben tRNA-Leu
  3591. Salmonella enterica subsp. enterica serovar Augustenborg tRNA-Leu
  3592. Salmonella enterica subsp. enterica serovar Austin tRNA-Leu
  3593. Salmonella enterica subsp. enterica serovar Baguida tRNA-Leu
  3594. Salmonella enterica subsp. enterica serovar Bahati tRNA-Leu
  3595. Salmonella enterica subsp. enterica serovar Bahrenfeld tRNA-Leu
  3596. Salmonella enterica subsp. enterica serovar Baildon str. R6-199 tRNA-Leu
  3597. Salmonella enterica subsp. enterica serovar Baildon tRNA-Leu
  3598. Salmonella enterica subsp. enterica serovar Bakau tRNA-Leu
  3599. Salmonella enterica subsp. enterica serovar Ball tRNA-Leu
  3600. Salmonella enterica subsp. enterica serovar Banana tRNA-Leu
  3601. Salmonella enterica subsp. enterica serovar Bardo tRNA-Leu
  3602. Salmonella enterica subsp. enterica serovar Bareilly str. 2780 tRNA-Leu
  3603. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000181 tRNA-Leu
  3604. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000197 tRNA-Leu
  3605. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000207 tRNA-Leu
  3606. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000235 tRNA-Leu
  3607. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000236 tRNA-Leu
  3608. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000754 tRNA-Leu
  3609. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001114 tRNA-Leu
  3610. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001117 tRNA-Leu
  3611. Salmonella enterica subsp. enterica serovar Bareilly tRNA-Leu
  3612. Salmonella enterica subsp. enterica serovar Bargny tRNA-Leu
  3613. Salmonella enterica subsp. enterica serovar Barranquilla tRNA-Leu
  3614. Salmonella enterica subsp. enterica serovar Beaudesert tRNA-Leu
  3615. Salmonella enterica subsp. enterica serovar Belfast tRNA-Leu
  3616. Salmonella enterica subsp. enterica serovar Benin tRNA-Leu
  3617. Salmonella enterica subsp. enterica serovar Bere tRNA-Leu
  3618. Salmonella enterica subsp. enterica serovar Bergen str. ST350 tRNA-Leu
  3619. Salmonella enterica subsp. enterica serovar Bergen tRNA-Leu
  3620. Salmonella enterica subsp. enterica serovar Berkeley tRNA-Leu
  3621. Salmonella enterica subsp. enterica serovar Berlin tRNA-Leu
  3622. Salmonella enterica subsp. enterica serovar Berta str. ATCC 8392 tRNA-Leu
  3623. Salmonella enterica subsp. enterica serovar Berta str. SA20103550 tRNA-Leu
  3624. Salmonella enterica subsp. enterica serovar Berta tRNA-Leu
  3625. Salmonella enterica subsp. enterica serovar Bietri tRNA-Leu
  3626. Salmonella enterica subsp. enterica serovar Bijlmer tRNA-Leu
  3627. Salmonella enterica subsp. enterica serovar Binza tRNA-Leu
  3628. Salmonella enterica subsp. enterica serovar Birkenhead tRNA-Leu
  3629. Salmonella enterica subsp. enterica serovar Bispebjerg tRNA-Leu
  3630. Salmonella enterica subsp. enterica serovar Blegdam str. S-1824 tRNA-Leu
  3631. Salmonella enterica subsp. enterica serovar Blegdam tRNA-Leu
  3632. Salmonella enterica subsp. enterica serovar Blockley tRNA-Leu
  3633. Salmonella enterica subsp. enterica serovar Blukwa tRNA-Leu
  3634. Salmonella enterica subsp. enterica serovar Bochum tRNA-Leu
  3635. Salmonella enterica subsp. enterica serovar Bonariensis tRNA-Leu
  3636. Salmonella enterica subsp. enterica serovar Bonn tRNA-Leu
  3637. Salmonella enterica subsp. enterica serovar Borreze str. SA20041063 tRNA-Leu
  3638. Salmonella enterica subsp. enterica serovar Bovismorbificans str. 3114 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3639. Salmonella enterica subsp. enterica serovar Bovismorbificans str. Sal610 tRNA-Leu
  3640. Salmonella enterica subsp. enterica serovar Bovismorbificans tRNA-Leu
  3641. Salmonella enterica subsp. enterica serovar Bracknell tRNA-Leu
  3642. Salmonella enterica subsp. enterica serovar Braenderup str. ATCC BAA-664 tRNA-Leu
  3643. Salmonella enterica subsp. enterica serovar Braenderup str. CFSAN000756 tRNA-Leu
  3644. Salmonella enterica subsp. enterica serovar Braenderup str. CFSAN001745 tRNA-Leu
  3645. Salmonella enterica subsp. enterica serovar Braenderup tRNA-Leu
  3646. Salmonella enterica subsp. enterica serovar Brancaster tRNA-Leu
  3647. Salmonella enterica subsp. enterica serovar Brandenburg tRNA-Leu
  3648. Salmonella enterica subsp. enterica serovar Brazzaville tRNA-Leu
  3649. Salmonella enterica subsp. enterica serovar Breda tRNA-Leu
  3650. Salmonella enterica subsp. enterica serovar Bredeney str. CFSAN001080 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3651. Salmonella enterica subsp. enterica serovar Bredeney tRNA-Leu
  3652. Salmonella enterica subsp. enterica serovar Breukelen tRNA-Leu
  3653. Salmonella enterica subsp. enterica serovar Brevik tRNA-Leu
  3654. Salmonella enterica subsp. enterica serovar Brijbhumi tRNA-Leu
  3655. Salmonella enterica subsp. enterica serovar Bristol tRNA-Leu
  3656. Salmonella enterica subsp. enterica serovar Bron tRNA-Leu
  3657. Salmonella enterica subsp. enterica serovar Bruck tRNA-Leu
  3658. Salmonella enterica subsp. enterica serovar Brunei tRNA-Leu
  3659. Salmonella enterica subsp. enterica serovar Buckeye tRNA-Leu
  3660. Salmonella enterica subsp. enterica serovar Bukavu tRNA-Leu
  3661. Salmonella enterica subsp. enterica serovar Butantan tRNA-Leu
  3662. Salmonella enterica subsp. enterica serovar Buzu tRNA-Leu
  3663. Salmonella enterica subsp. enterica serovar Cairina tRNA-Leu
  3664. Salmonella enterica subsp. enterica serovar Calabar tRNA-Leu
  3665. Salmonella enterica subsp. enterica serovar California tRNA-Leu
  3666. Salmonella enterica subsp. enterica serovar Canada tRNA-Leu
  3667. Salmonella enterica subsp. enterica serovar Cannstatt tRNA-Leu
  3668. Salmonella enterica subsp. enterica serovar Caracas tRNA-Leu
  3669. Salmonella enterica subsp. enterica serovar Cardoner tRNA-Leu
  3670. Salmonella enterica subsp. enterica serovar Carmel tRNA-Leu
  3671. Salmonella enterica subsp. enterica serovar Carno tRNA-Leu
  3672. Salmonella enterica subsp. enterica serovar Carrau tRNA-Leu
  3673. Salmonella enterica subsp. enterica serovar Cerro str. FSL R8-0235 tRNA-Leu
  3674. Salmonella enterica subsp. enterica serovar Cerro str. 5569 tRNA-Leu
  3675. Salmonella enterica subsp. enterica serovar Cerro str. 818 tRNA-Leu
  3676. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001587 tRNA-Leu
  3677. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001588 tRNA-Leu
  3678. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001589 tRNA-Leu
  3679. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001590 tRNA-Leu
  3680. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001669 tRNA-Leu
  3681. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001670 tRNA-Leu
  3682. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001671 tRNA-Leu
  3683. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001673 tRNA-Leu
  3684. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001674 tRNA-Leu
  3685. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001679 tRNA-Leu
  3686. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001680 tRNA-Leu
  3687. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001681 tRNA-Leu
  3688. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001690 tRNA-Leu
  3689. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001691 tRNA-Leu
  3690. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001692 tRNA-Leu
  3691. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001697 tRNA-Leu
  3692. Salmonella enterica subsp. enterica serovar Cerro tRNA-Leu
  3693. Salmonella enterica subsp. enterica serovar Ceyco tRNA-Leu
  3694. Salmonella enterica subsp. enterica serovar Chailey tRNA-Leu
  3695. Salmonella enterica subsp. enterica serovar Champaign tRNA-Leu
  3696. Salmonella enterica subsp. enterica serovar Chandans tRNA-Leu
  3697. Salmonella enterica subsp. enterica serovar Chester str. ATCC 11997 tRNA-Leu
  3698. Salmonella enterica subsp. enterica serovar Chester tRNA-Leu
  3699. Salmonella enterica subsp. enterica serovar Chicago tRNA-Leu
  3700. Salmonella enterica subsp. enterica serovar Chichester tRNA-Leu
  3701. Salmonella enterica subsp. enterica serovar Chincol tRNA-Leu
  3702. Salmonella enterica subsp. enterica serovar Chittagong tRNA-Leu
  3703. Salmonella enterica subsp. enterica serovar Choleraesuis str. 0006 tRNA-Leu
  3704. Salmonella enterica subsp. enterica serovar Choleraesuis str. ATCC 10708 tRNA-Leu
  3705. Salmonella enterica subsp. enterica serovar Choleraesuis str. CFSAN000514 tRNA-Leu
  3706. Salmonella enterica subsp. enterica serovar Choleraesuis str. CFSAN000515 tRNA-Leu
  3707. Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3708. Salmonella enterica subsp. enterica serovar Choleraesuis str. SCSA50 tRNA-Leu
  3709. Salmonella enterica subsp. enterica serovar Choleraesuis tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3710. Salmonella enterica subsp. enterica serovar Chomedey tRNA-Leu
  3711. Salmonella enterica subsp. enterica serovar Clackamas tRNA-Leu
  3712. Salmonella enterica subsp. enterica serovar Claibornei tRNA-Leu
  3713. Salmonella enterica subsp. enterica serovar Coeln tRNA-Leu
  3714. Salmonella enterica subsp. enterica serovar Coleypark tRNA-Leu
  3715. Salmonella enterica subsp. enterica serovar Colindale tRNA-Leu
  3716. Salmonella enterica subsp. enterica serovar Colorado tRNA-Leu
  3717. Salmonella enterica subsp. enterica serovar Concord tRNA-Leu
  3718. Salmonella enterica subsp. enterica serovar Copenhagen tRNA-Leu
  3719. Salmonella enterica subsp. enterica serovar Coquilhatville tRNA-Leu
  3720. Salmonella enterica subsp. enterica serovar Corvallis tRNA-Leu
  3721. Salmonella enterica subsp. enterica serovar Cotham tRNA-Leu
  3722. Salmonella enterica subsp. enterica serovar Cremieu tRNA-Leu
  3723. Salmonella enterica subsp. enterica serovar Crossness str. 1422-74 tRNA-Leu
  3724. Salmonella enterica subsp. enterica serovar Cubana str. 76814 tRNA-Leu
  3725. Salmonella enterica subsp. enterica serovar Cubana str. CFSAN001083 tRNA-Leu
  3726. Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3727. Salmonella enterica subsp. enterica serovar Cubana str. CVM42234 tRNA-Leu
  3728. Salmonella enterica subsp. enterica serovar Cubana tRNA-Leu
  3729. Salmonella enterica subsp. enterica serovar Cullingworth tRNA-Leu
  3730. Salmonella enterica subsp. enterica serovar Curacao tRNA-Leu
  3731. Salmonella enterica subsp. enterica serovar Dabou tRNA-Leu
  3732. Salmonella enterica subsp. enterica serovar Daytona tRNA-Leu
  3733. Salmonella enterica subsp. enterica serovar Decatur tRNA-Leu
  3734. Salmonella enterica subsp. enterica serovar Denver tRNA-Leu
  3735. Salmonella enterica subsp. enterica serovar Derby str. 626 tRNA-Leu
  3736. Salmonella enterica subsp. enterica serovar Derby str. CFSAN000564 tRNA-Leu
  3737. Salmonella enterica subsp. enterica serovar Derby str. CFSAN000565 tRNA-Leu
  3738. Salmonella enterica subsp. enterica serovar Derby str. CFSAN000566 tRNA-Leu
  3739. Salmonella enterica subsp. enterica serovar Derby tRNA-Leu
  3740. Salmonella enterica subsp. enterica serovar Dessau tRNA-Leu
  3741. Salmonella enterica subsp. enterica serovar Diguel tRNA-Leu
  3742. Salmonella enterica subsp. enterica serovar Djakarta str. S-1087 tRNA-Leu
  3743. Salmonella enterica subsp. enterica serovar Djugu tRNA-Leu
  3744. Salmonella enterica subsp. enterica serovar Dortmund tRNA-Leu
  3745. Salmonella enterica subsp. enterica serovar Dublin str. 0773 tRNA-Leu
  3746. Salmonella enterica subsp. enterica serovar Dublin str. ATCC 39184 tRNA-Leu
  3747. Salmonella enterica subsp. enterica serovar Dublin str. CFSAN000517 tRNA-Leu
  3748. Salmonella enterica subsp. enterica serovar Dublin str. CFSAN000518 tRNA-Leu
  3749. Salmonella enterica subsp. enterica serovar Dublin str. CT_02021853 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3750. Salmonella enterica subsp. enterica serovar Dublin str. DG22 tRNA-Leu
  3751. Salmonella enterica subsp. enterica serovar Dublin str. SA20093032 tRNA-Leu
  3752. Salmonella enterica subsp. enterica serovar Dublin str. SD3246 tRNA-Leu
  3753. Salmonella enterica subsp. enterica serovar Dublin str. SL1438 tRNA-Leu
  3754. Salmonella enterica subsp. enterica serovar Dublin str. UC16 tRNA-Leu
  3755. Salmonella enterica subsp. enterica serovar Dublin tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3756. Salmonella enterica subsp. enterica serovar Duesseldorf tRNA-Leu
  3757. Salmonella enterica subsp. enterica serovar Dugbe tRNA-Leu
  3758. Salmonella enterica subsp. enterica serovar Duisburg tRNA-Leu
  3759. Salmonella enterica subsp. enterica serovar Durban tRNA-Leu
  3760. Salmonella enterica subsp. enterica serovar Durham tRNA-Leu
  3761. Salmonella enterica subsp. enterica serovar Ealing tRNA-Leu
  3762. Salmonella enterica subsp. enterica serovar Eastbourne str. CFSAN001084 tRNA-Leu
  3763. Salmonella enterica subsp. enterica serovar Eastbourne tRNA-Leu
  3764. Salmonella enterica subsp. enterica serovar Eboko tRNA-Leu
  3765. Salmonella enterica subsp. enterica serovar Eingedi tRNA-Leu
  3766. Salmonella enterica subsp. enterica serovar Ekotedo tRNA-Leu
  3767. Salmonella enterica subsp. enterica serovar Eko tRNA-Leu
  3768. Salmonella enterica subsp. enterica serovar Ekpoui tRNA-Leu
  3769. Salmonella enterica subsp. enterica serovar Elisabethville tRNA-Leu
  3770. Salmonella enterica subsp. enterica serovar Elomrane tRNA-Leu
  3771. Salmonella enterica subsp. enterica serovar Emek tRNA-Leu
  3772. Salmonella enterica subsp. enterica serovar Enteritidis str. 08-1080 tRNA-Leu
  3773. Salmonella enterica subsp. enterica serovar Enteritidis str. 10-34587 tRNA-Leu
  3774. Salmonella enterica subsp. enterica serovar Enteritidis str. 13183-1 tRNA-Leu
  3775. Salmonella enterica subsp. enterica serovar Enteritidis str. 13-1 tRNA-Leu
  3776. Salmonella enterica subsp. enterica serovar Enteritidis str. 17927 tRNA-Leu
  3777. Salmonella enterica subsp. enterica serovar Enteritidis str. 18569 tRNA-Leu
  3778. Salmonella enterica subsp. enterica serovar Enteritidis str. 20037 tRNA-Leu
  3779. Salmonella enterica subsp. enterica serovar Enteritidis str. 2009K0958 tRNA-Leu
  3780. Salmonella enterica subsp. enterica serovar Enteritidis str. 2009K1651 tRNA-Leu
  3781. Salmonella enterica subsp. enterica serovar Enteritidis str. 2009K1726 tRNA-Leu
  3782. Salmonella enterica subsp. enterica serovar Enteritidis str. 2010K-0262 tRNA-Leu
  3783. Salmonella enterica subsp. enterica serovar Enteritidis str. 2010K-0267 tRNA-Leu
  3784. Salmonella enterica subsp. enterica serovar Enteritidis str. 2010K-0271 tRNA-Leu
  3785. Salmonella enterica subsp. enterica serovar Enteritidis str. 2010K-0284 tRNA-Leu
  3786. Salmonella enterica subsp. enterica serovar Enteritidis str. 2010K-0286 tRNA-Leu
  3787. Salmonella enterica subsp. enterica serovar Enteritidis str. 22510-1 tRNA-Leu
  3788. Salmonella enterica subsp. enterica serovar Enteritidis str. 22558 tRNA-Leu
  3789. Salmonella enterica subsp. enterica serovar Enteritidis str. 22704 tRNA-Leu
  3790. Salmonella enterica subsp. enterica serovar Enteritidis str. 33944 tRNA-Leu
  3791. Salmonella enterica subsp. enterica serovar Enteritidis str. 3402 tRNA-Leu
  3792. Salmonella enterica subsp. enterica serovar Enteritidis str. 436 tRNA-Leu
  3793. Salmonella enterica subsp. enterica serovar Enteritidis str. 485549-17 tRNA-Leu
  3794. Salmonella enterica subsp. enterica serovar Enteritidis str. 50-3079 tRNA-Leu
  3795. Salmonella enterica subsp. enterica serovar Enteritidis str. 50-5646 tRNA-Leu
  3796. Salmonella enterica subsp. enterica serovar Enteritidis str. 53-407 tRNA-Leu
  3797. Salmonella enterica subsp. enterica serovar Enteritidis str. 543463 22-17 tRNA-Leu
  3798. Salmonella enterica subsp. enterica serovar Enteritidis str. 543463 40-18 tRNA-Leu
  3799. Salmonella enterica subsp. enterica serovar Enteritidis str. 543463 42-20 tRNA-Leu
  3800. Salmonella enterica subsp. enterica serovar Enteritidis str. 561362 1-1 tRNA-Leu
  3801. Salmonella enterica subsp. enterica serovar Enteritidis str. 561362 9-7 tRNA-Leu
  3802. Salmonella enterica subsp. enterica serovar Enteritidis str. 576709 tRNA-Leu
  3803. Salmonella enterica subsp. enterica serovar Enteritidis str. 58-6482 tRNA-Leu
  3804. Salmonella enterica subsp. enterica serovar Enteritidis str. 596866-22 tRNA-Leu
  3805. Salmonella enterica subsp. enterica serovar Enteritidis str. 596866-70 tRNA-Leu
  3806. Salmonella enterica subsp. enterica serovar Enteritidis str. 6.0562-1 tRNA-Leu
  3807. Salmonella enterica subsp. enterica serovar Enteritidis str. 607307-2 tRNA-Leu
  3808. Salmonella enterica subsp. enterica serovar Enteritidis str. 607307-6 tRNA-Leu
  3809. Salmonella enterica subsp. enterica serovar Enteritidis str. 607308-16 tRNA-Leu
  3810. Salmonella enterica subsp. enterica serovar Enteritidis str. 607308-19 tRNA-Leu
  3811. Salmonella enterica subsp. enterica serovar Enteritidis str. 607308-9 tRNA-Leu
  3812. Salmonella enterica subsp. enterica serovar Enteritidis str. 62-1976 tRNA-Leu
  3813. Salmonella enterica subsp. enterica serovar Enteritidis str. 622731-39 tRNA-Leu
  3814. Salmonella enterica subsp. enterica serovar Enteritidis str. 629163 tRNA-Leu
  3815. Salmonella enterica subsp. enterica serovar Enteritidis str. 629164-26 tRNA-Leu
  3816. Salmonella enterica subsp. enterica serovar Enteritidis str. 629164-37 tRNA-Leu
  3817. Salmonella enterica subsp. enterica serovar Enteritidis str. 635290-58 tRNA-Leu
  3818. Salmonella enterica subsp. enterica serovar Enteritidis str. 638970-15 tRNA-Leu
  3819. Salmonella enterica subsp. enterica serovar Enteritidis str. 639016-6 tRNA-Leu
  3820. Salmonella enterica subsp. enterica serovar Enteritidis str. 639672-46 tRNA-Leu
  3821. Salmonella enterica subsp. enterica serovar Enteritidis str. 639672-50 tRNA-Leu
  3822. Salmonella enterica subsp. enterica serovar Enteritidis str. 640631 tRNA-Leu
  3823. Salmonella enterica subsp. enterica serovar Enteritidis str. 642044 4-1 tRNA-Leu
  3824. Salmonella enterica subsp. enterica serovar Enteritidis str. 642044 8-1 tRNA-Leu
  3825. Salmonella enterica subsp. enterica serovar Enteritidis str. 642046 4-7 tRNA-Leu
  3826. Salmonella enterica subsp. enterica serovar Enteritidis str. 648898 4-5 tRNA-Leu
  3827. Salmonella enterica subsp. enterica serovar Enteritidis str. 648899 3-17 tRNA-Leu
  3828. Salmonella enterica subsp. enterica serovar Enteritidis str. 648900 1-16 tRNA-Leu
  3829. Salmonella enterica subsp. enterica serovar Enteritidis str. 648901 1-17 tRNA-Leu
  3830. Salmonella enterica subsp. enterica serovar Enteritidis str. 648901 16-16 tRNA-Leu
  3831. Salmonella enterica subsp. enterica serovar Enteritidis str. 648901 39-2 tRNA-Leu
  3832. Salmonella enterica subsp. enterica serovar Enteritidis str. 648901 6-18 tRNA-Leu
  3833. Salmonella enterica subsp. enterica serovar Enteritidis str. 648902 6-8 tRNA-Leu
  3834. Salmonella enterica subsp. enterica serovar Enteritidis str. 648903 1-6 tRNA-Leu
  3835. Salmonella enterica subsp. enterica serovar Enteritidis str. 648904 3-6 tRNA-Leu
  3836. Salmonella enterica subsp. enterica serovar Enteritidis str. 648905 5-18 tRNA-Leu
  3837. Salmonella enterica subsp. enterica serovar Enteritidis str. 653049 13-19 tRNA-Leu
  3838. Salmonella enterica subsp. enterica serovar Enteritidis str. 674470_11-10 tRNA-Leu
  3839. Salmonella enterica subsp. enterica serovar Enteritidis str. 76-2651 tRNA-Leu
  3840. Salmonella enterica subsp. enterica serovar Enteritidis str. 77-0424 tRNA-Leu
  3841. Salmonella enterica subsp. enterica serovar Enteritidis str. 77-1427 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3842. Salmonella enterica subsp. enterica serovar Enteritidis str. 77-2659 tRNA-Leu
  3843. Salmonella enterica subsp. enterica serovar Enteritidis str. 78-1757 tRNA-Leu
  3844. Salmonella enterica subsp. enterica serovar Enteritidis str. 81-2625 tRNA-Leu
  3845. Salmonella enterica subsp. enterica serovar Enteritidis str. 8b-1 tRNA-Leu
  3846. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_0895 tRNA-Leu
  3847. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_0899 tRNA-Leu
  3848. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_0956 tRNA-Leu
  3849. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_0968 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3850. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1010 tRNA-Leu
  3851. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1018 tRNA-Leu
  3852. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1441 tRNA-Leu
  3853. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1444 tRNA-Leu
  3854. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1445 tRNA-Leu
  3855. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1455 tRNA-Leu
  3856. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1457 tRNA-Leu
  3857. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1543 tRNA-Leu
  3858. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1558 tRNA-Leu
  3859. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1559 tRNA-Leu
  3860. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1565 tRNA-Leu
  3861. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1566 tRNA-Leu
  3862. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1575 tRNA-Leu
  3863. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1580 tRNA-Leu
  3864. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1594 tRNA-Leu
  3865. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1725 tRNA-Leu
  3866. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1729 tRNA-Leu
  3867. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1745 tRNA-Leu
  3868. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1747 tRNA-Leu
  3869. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1791 tRNA-Leu
  3870. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1795 tRNA-Leu
  3871. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1808 tRNA-Leu
  3872. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1810 tRNA-Leu
  3873. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1811 tRNA-Leu
  3874. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1882 tRNA-Leu
  3875. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1884 tRNA-Leu
  3876. Salmonella enterica subsp. enterica serovar Enteritidis str. CFSAN000052 tRNA-Leu
  3877. Salmonella enterica subsp. enterica serovar Enteritidis str. CFSAN000568 tRNA-Leu
  3878. Salmonella enterica subsp. enterica serovar Enteritidis str. CHS44 tRNA-Leu
  3879. Salmonella enterica subsp. enterica serovar Enteritidis str. CHS4 tRNA-Leu
  3880. Salmonella enterica subsp. enterica serovar Enteritidis str. CVM_56-3991 tRNA-Leu
  3881. Salmonella enterica subsp. enterica serovar Enteritidis str. CVM_69-4941 tRNA-Leu
  3882. Salmonella enterica subsp. enterica serovar Enteritidis str. CVM_76-3618 tRNA-Leu
  3883. Salmonella enterica subsp. enterica serovar Enteritidis str. CVM_81-2490 tRNA-Leu
  3884. Salmonella enterica subsp. enterica serovar Enteritidis str. CVM_N202 tRNA-Leu
  3885. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090135 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3886. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090193 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3887. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090195 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3888. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090332 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3889. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090530 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3890. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090531 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3891. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090641 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3892. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090698 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3893. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090884 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3894. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100088 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3895. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100089 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3896. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100100 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3897. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100101 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3898. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100103 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3899. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100130 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3900. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100131 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3901. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100134 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3902. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100325 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3903. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110221 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3904. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110222 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3905. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110223 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3906. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110353 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3907. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110354 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3908. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110355 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3909. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110356 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3910. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110357 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3911. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110358 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3912. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110359 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3913. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110360 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3914. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110361 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3915. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111095 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3916. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111174 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3917. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111175 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3918. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111510 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3919. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111514 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3920. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111515 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3921. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111554 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3922. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111561 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3923. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111576 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3924. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120002 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3925. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120003 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3926. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120005 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3927. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120007 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3928. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120008 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3929. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120009 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3930. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120051 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3931. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120200 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3932. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120213 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3933. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120219 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3934. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120229 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3935. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120240 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3936. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120356 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3937. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120469 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3938. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120496 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3939. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120497 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3940. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120498 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3941. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120505 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3942. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120528 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3943. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120544 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3944. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120548 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3945. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120555 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3946. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120580 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3947. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120581 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3948. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120590 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3949. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120597 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3950. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120677 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3951. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120685 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3952. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120686 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3953. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120687 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3954. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120697 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3955. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120722 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3956. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120734 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3957. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120738 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3958. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120765 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3959. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120773 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3960. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120774 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3961. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120775 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3962. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120776 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3963. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120916 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3964. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120917 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3965. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120918 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3966. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120925 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3967. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120927 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3968. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120929 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3969. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120963 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3970. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120968 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3971. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120969 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3972. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120970 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3973. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120994 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3974. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121004 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3975. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121175 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3976. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121176 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3977. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121177 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3978. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121178 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3979. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121179 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3980. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121180 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3981. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121541 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3982. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121542 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3983. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121671 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3984. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121672 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3985. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121689 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3986. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121744 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3987. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121746 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3988. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121747 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3989. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121748 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3990. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121750 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3991. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121751 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3992. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121753 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3993. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121765 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3994. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121812 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3995. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121825 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3996. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121826 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3997. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121969 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3998. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121970 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  3999. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121976 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4000. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121986 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4001. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121989 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4002. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121990 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4003. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20122022 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4004. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20122026 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4005. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20122031 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4006. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20122033 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4007. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20122045 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4008. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20130345 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4009. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20130346 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4010. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20130347 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4011. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20130348 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4012. Salmonella enterica subsp. enterica serovar Enteritidis str. P125109 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4013. Salmonella enterica subsp. enterica serovar Enteritidis str. PT23 tRNA-Leu
  4014. Salmonella enterica subsp. enterica serovar Enteritidis str. RM2968 tRNA-Leu
  4015. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19930684 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4016. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19940857 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4017. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19942384 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4018. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19943269 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4019. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19960848 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4020. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19961622 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4021. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19970510 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4022. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19970769 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4023. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19971331 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4024. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19980677 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4025. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19981522 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4026. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19981857 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4027. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19982831 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4028. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19983126 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4029. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19992322 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4030. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19994216 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4031. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20082034 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4032. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20083456 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4033. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20083636 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4034. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20084384 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4035. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20084644 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4036. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20084824 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4037. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20085285 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4038. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20090419 tRNA-Leu
  4039. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20090435 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4040. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20090877 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4041. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20091739 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4042. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20092320 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4043. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093266 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4044. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093421 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4045. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093430 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4046. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093538 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4047. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093543 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4048. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093784 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4049. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093788 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4050. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093950 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4051. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093977 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4052. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094079 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4053. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094177 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4054. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094301 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4055. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094350 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4056. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094352 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4057. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094383 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4058. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094389 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4059. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094521 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4060. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094642 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4061. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094682 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4062. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094803 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4063. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20095309 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4064. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20095440 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4065. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20100239 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4066. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20100349 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4067. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20121703 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4068. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20123395 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4069. Salmonella enterica subsp. enterica serovar Enteritidis str. SARB17 tRNA-Leu
  4070. Salmonella enterica subsp. enterica serovar Enteritidis str. SE10 tRNA-Leu
  4071. Salmonella enterica subsp. enterica serovar Enteritidis str. SE15-1 tRNA-Leu
  4072. Salmonella enterica subsp. enterica serovar Enteritidis str. SE30663 tRNA-Leu
  4073. Salmonella enterica subsp. enterica serovar Enteritidis str. SE8a tRNA-Leu
  4074. Salmonella enterica subsp. enterica serovar Enteritidis str. SHSE001 tRNA-Leu
  4075. Salmonella enterica subsp. enterica serovar Enteritidis str. SHSE002 tRNA-Leu
  4076. Salmonella enterica subsp. enterica serovar Enteritidis str. SHSE003 tRNA-Leu
  4077. Salmonella enterica subsp. enterica serovar Enteritidis str. SHSE004 tRNA-Leu
  4078. Salmonella enterica subsp. enterica serovar Enteritidis str. SL909 tRNA-Leu
  4079. Salmonella enterica subsp. enterica serovar Enteritidis str. SL913 tRNA-Leu
  4080. Salmonella enterica subsp. enterica serovar Enteritidis tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4081. Salmonella enterica subsp. enterica serovar Enugu tRNA-Leu
  4082. Salmonella enterica subsp. enterica serovar Eppendorf tRNA-Leu
  4083. Salmonella enterica subsp. enterica serovar Eschberg tRNA-Leu
  4084. Salmonella enterica subsp. enterica serovar Essen tRNA-Leu
  4085. Salmonella enterica subsp. enterica serovar Everleigh tRNA-Leu
  4086. Salmonella enterica subsp. enterica serovar Falkensee tRNA-Leu
  4087. Salmonella enterica subsp. enterica serovar Fallowfield tRNA-Leu
  4088. Salmonella enterica subsp. enterica serovar Fann tRNA-Leu
  4089. Salmonella enterica subsp. enterica serovar Fanti tRNA-Leu
  4090. Salmonella enterica subsp. enterica serovar Farmsen tRNA-Leu
  4091. Salmonella enterica subsp. enterica serovar Florian tRNA-Leu
  4092. Salmonella enterica subsp. enterica serovar Florida tRNA-Leu
  4093. Salmonella enterica subsp. enterica serovar Flottbek tRNA-Leu
  4094. Salmonella enterica subsp. enterica serovar Fluntern tRNA-Leu
  4095. Salmonella enterica subsp. enterica serovar Freetown tRNA-Leu
  4096. Salmonella enterica subsp. enterica serovar Fresno str. ST224 tRNA-Leu
  4097. Salmonella enterica subsp. enterica serovar Fresno tRNA-Leu
  4098. Salmonella enterica subsp. enterica serovar Frintrop tRNA-Leu
  4099. Salmonella enterica subsp. enterica serovar Fufu tRNA-Leu
  4100. Salmonella enterica subsp. enterica serovar Fulica tRNA-Leu
  4101. Salmonella enterica subsp. enterica serovar Gafsa tRNA-Leu
  4102. Salmonella enterica subsp. enterica serovar Galiema tRNA-Leu
  4103. Salmonella enterica subsp. enterica serovar Gallinarum/Pullorum str. CDC1983-67 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4104. Salmonella enterica subsp. enterica serovar Gallinarum/Pullorum str. FCAV198 tRNA-Leu
  4105. Salmonella enterica subsp. enterica serovar Gallinarum/Pullorum str. RKS5078 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4106. Salmonella enterica subsp. enterica serovar Gallinarum/Pullorum tRNA-Leu
  4107. Salmonella enterica subsp. enterica serovar Gallinarum tRNA-Leu
  4108. Salmonella enterica subsp. enterica serovar Gambia tRNA-Leu
  4109. Salmonella enterica subsp. enterica serovar Gaminara tRNA-Leu
  4110. Salmonella enterica subsp. enterica serovar Garoli tRNA-Leu
  4111. Salmonella enterica subsp. enterica serovar Gatineau tRNA-Leu
  4112. Salmonella enterica subsp. enterica serovar Gatow tRNA-Leu
  4113. Salmonella enterica subsp. enterica serovar Gatuni tRNA-Leu
  4114. Salmonella enterica subsp. enterica serovar Gdansk tRNA-Leu
  4115. Salmonella enterica subsp. enterica serovar Georgia tRNA-Leu
  4116. Salmonella enterica subsp. enterica serovar Geraldton tRNA-Leu
  4117. Salmonella enterica subsp. enterica serovar Giessen tRNA-Leu
  4118. Salmonella enterica subsp. enterica serovar Give str. 564 tRNA-Leu
  4119. Salmonella enterica subsp. enterica serovar Give str. S5-487 tRNA-Leu
  4120. Salmonella enterica subsp. enterica serovar Give tRNA-Leu
  4121. Salmonella enterica subsp. enterica serovar Give var. 15 str. CFSAN004343 tRNA-Leu
  4122. Salmonella enterica subsp. enterica serovar Glostrup tRNA-Leu
  4123. Salmonella enterica subsp. enterica serovar Gloucester tRNA-Leu
  4124. Salmonella enterica subsp. enterica serovar Gokul tRNA-Leu
  4125. Salmonella enterica subsp. enterica serovar Goldcoast tRNA-Leu
  4126. Salmonella enterica subsp. enterica serovar Gombe tRNA-Leu
  4127. Salmonella enterica subsp. enterica serovar Goverdhan tRNA-Leu
  4128. Salmonella enterica subsp. enterica serovar Grumpensis tRNA-Leu
  4129. Salmonella enterica subsp. enterica serovar Gueuletapee tRNA-Leu
  4130. Salmonella enterica subsp. enterica serovar Guildford tRNA-Leu
  4131. Salmonella enterica subsp. enterica serovar Guinea tRNA-Leu
  4132. Salmonella enterica subsp. enterica serovar Haardt tRNA-Leu
  4133. Salmonella enterica subsp. enterica serovar Hadar str. ATCC 51956 tRNA-Leu
  4134. Salmonella enterica subsp. enterica serovar Hadar str. SA20026260 tRNA-Leu
  4135. Salmonella enterica subsp. enterica serovar Hadar tRNA-Leu
  4136. Salmonella enterica subsp. enterica serovar Haduna tRNA-Leu
  4137. Salmonella enterica subsp. enterica serovar Haga tRNA-Leu
  4138. Salmonella enterica subsp. enterica serovar Haifa tRNA-Leu
  4139. Salmonella enterica subsp. enterica serovar Halle tRNA-Leu
  4140. Salmonella enterica subsp. enterica serovar Hartford str. CFSAN001075 tRNA-Leu
  4141. Salmonella enterica subsp. enterica serovar Hartford tRNA-Leu
  4142. Salmonella enterica subsp. enterica serovar Hato tRNA-Leu
  4143. Salmonella enterica subsp. enterica serovar Havana str. CFSAN001082 tRNA-Leu
  4144. Salmonella enterica subsp. enterica serovar Havana tRNA-Leu
  4145. Salmonella enterica subsp. enterica serovar Hayindogo tRNA-Leu
  4146. Salmonella enterica subsp. enterica serovar Heidelberg str. 21381 tRNA-Leu
  4147. Salmonella enterica subsp. enterica serovar Heidelberg str. 24390 tRNA-Leu
  4148. Salmonella enterica subsp. enterica serovar Heidelberg str. 24393 tRNA-Leu
  4149. Salmonella enterica subsp. enterica serovar Heidelberg str. 29169 tRNA-Leu
  4150. Salmonella enterica subsp. enterica serovar Heidelberg str. 32507 tRNA-Leu
  4151. Salmonella enterica subsp. enterica serovar Heidelberg str. 41563 tRNA-Leu
  4152. Salmonella enterica subsp. enterica serovar Heidelberg str. 41565 tRNA-Leu
  4153. Salmonella enterica subsp. enterica serovar Heidelberg str. 41566 tRNA-Leu
  4154. Salmonella enterica subsp. enterica serovar Heidelberg str. 41567 tRNA-Leu
  4155. Salmonella enterica subsp. enterica serovar Heidelberg str. 41573 tRNA-Leu
  4156. Salmonella enterica subsp. enterica serovar Heidelberg str. 41576 tRNA-Leu
  4157. Salmonella enterica subsp. enterica serovar Heidelberg str. 41578 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4158. Salmonella enterica subsp. enterica serovar Heidelberg str. 41579 tRNA-Leu
  4159. Salmonella enterica subsp. enterica serovar Heidelberg str. 41584 tRNA-Leu
  4160. Salmonella enterica subsp. enterica serovar Heidelberg str. 579082-8 tRNA-Leu
  4161. Salmonella enterica subsp. enterica serovar Heidelberg str. 579083-10 tRNA-Leu
  4162. Salmonella enterica subsp. enterica serovar Heidelberg str. 579083-19 tRNA-Leu
  4163. Salmonella enterica subsp. enterica serovar Heidelberg str. 607309-34 tRNA-Leu
  4164. Salmonella enterica subsp. enterica serovar Heidelberg str. 607309-5 tRNA-Leu
  4165. Salmonella enterica subsp. enterica serovar Heidelberg str. 607310-1 tRNA-Leu
  4166. Salmonella enterica subsp. enterica serovar Heidelberg str. 622737-11 tRNA-Leu
  4167. Salmonella enterica subsp. enterica serovar Heidelberg str. 622737-12 tRNA-Leu
  4168. Salmonella enterica subsp. enterica serovar Heidelberg str. 622737-14 tRNA-Leu
  4169. Salmonella enterica subsp. enterica serovar Heidelberg str. 622737-21 tRNA-Leu
  4170. Salmonella enterica subsp. enterica serovar Heidelberg str. 632675-24 tRNA-Leu
  4171. Salmonella enterica subsp. enterica serovar Heidelberg str. 638982-15 tRNA-Leu
  4172. Salmonella enterica subsp. enterica serovar Heidelberg str. 638982-21 tRNA-Leu
  4173. Salmonella enterica subsp. enterica serovar Heidelberg str. 640151-11 tRNA-Leu
  4174. Salmonella enterica subsp. enterica serovar Heidelberg str. 670102-3 tRNA-Leu
  4175. Salmonella enterica subsp. enterica serovar Heidelberg str. 670102-5 tRNA-Leu
  4176. Salmonella enterica subsp. enterica serovar Heidelberg str. 75-3547 tRNA-Leu
  4177. Salmonella enterica subsp. enterica serovar Heidelberg str. 76-0300 tRNA-Leu
  4178. Salmonella enterica subsp. enterica serovar Heidelberg str. 77-1831 tRNA-Leu
  4179. Salmonella enterica subsp. enterica serovar Heidelberg str. 77-2823 tRNA-Leu
  4180. Salmonella enterica subsp. enterica serovar Heidelberg str. 79-0480 tRNA-Leu
  4181. Salmonella enterica subsp. enterica serovar Heidelberg str. 82-1617 tRNA-Leu
  4182. Salmonella enterica subsp. enterica serovar Heidelberg str. 82-2052 tRNA-Leu
  4183. Salmonella enterica subsp. enterica serovar Heidelberg str. 83-1068 tRNA-Leu
  4184. Salmonella enterica subsp. enterica serovar Heidelberg str. 84-1004 tRNA-Leu
  4185. Salmonella enterica subsp. enterica serovar Heidelberg str. 85-0486 tRNA-Leu
  4186. Salmonella enterica subsp. enterica serovar Heidelberg str. 86-0255 tRNA-Leu
  4187. Salmonella enterica subsp. enterica serovar Heidelberg str. 87-0208 tRNA-Leu
  4188. Salmonella enterica subsp. enterica serovar Heidelberg str. 88-0312 tRNA-Leu
  4189. Salmonella enterica subsp. enterica serovar Heidelberg str. 89-0213 tRNA-Leu
  4190. Salmonella enterica subsp. enterica serovar Heidelberg str. 90-0318 tRNA-Leu
  4191. Salmonella enterica subsp. enterica serovar Heidelberg str. 92-0138 tRNA-Leu
  4192. Salmonella enterica subsp. enterica serovar Heidelberg str. 92-0144 tRNA-Leu
  4193. Salmonella enterica subsp. enterica serovar Heidelberg str. B182 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4194. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN000577 tRNA-Leu
  4195. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN000578 tRNA-Leu
  4196. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN001902 tRNA-Leu
  4197. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN001914 tRNA-Leu
  4198. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002056 tRNA-Leu
  4199. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002057 tRNA-Leu
  4200. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002058 tRNA-Leu
  4201. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002059 tRNA-Leu
  4202. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002060 tRNA-Leu
  4203. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002061 tRNA-Leu
  4204. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002062 tRNA-Leu
  4205. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002063 tRNA-Leu
  4206. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002064 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4207. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002065 tRNA-Leu
  4208. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002066 tRNA-Leu
  4209. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002067 tRNA-Leu
  4210. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002068 tRNA-Leu
  4211. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4212. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002071 tRNA-Leu
  4213. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002072 tRNA-Leu
  4214. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002073 tRNA-Leu
  4215. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002074 tRNA-Leu
  4216. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002075 tRNA-Leu
  4217. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00322 tRNA-Leu
  4218. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00323 tRNA-Leu
  4219. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00324 tRNA-Leu
  4220. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00325 tRNA-Leu
  4221. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00326 tRNA-Leu
  4222. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00327 tRNA-Leu
  4223. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00328 tRNA-Leu
  4224. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003462 tRNA-Leu
  4225. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003463 tRNA-Leu
  4226. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003465 tRNA-Leu
  4227. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003467 tRNA-Leu
  4228. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003468 tRNA-Leu
  4229. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003469 tRNA-Leu
  4230. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003472 tRNA-Leu
  4231. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003475 tRNA-Leu
  4232. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003480 tRNA-Leu
  4233. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003482 tRNA-Leu
  4234. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003484 tRNA-Leu
  4235. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003485 tRNA-Leu
  4236. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003487 tRNA-Leu
  4237. Salmonella enterica subsp. enterica serovar Heidelberg str. CVM20752 tRNA-Leu
  4238. Salmonella enterica subsp. enterica serovar Heidelberg str. CVM24359 tRNA-Leu
  4239. Salmonella enterica subsp. enterica serovar Heidelberg str. CVM24388 tRNA-Leu
  4240. Salmonella enterica subsp. enterica serovar Heidelberg str. CVM24391 tRNA-Leu
  4241. Salmonella enterica subsp. enterica serovar Heidelberg str. N1514 tRNA-Leu
  4242. Salmonella enterica subsp. enterica serovar Heidelberg str. N1536 tRNA-Leu
  4243. Salmonella enterica subsp. enterica serovar Heidelberg str. N15757 tRNA-Leu
  4244. Salmonella enterica subsp. enterica serovar Heidelberg str. N18393 tRNA-Leu
  4245. Salmonella enterica subsp. enterica serovar Heidelberg str. N18413 tRNA-Leu
  4246. Salmonella enterica subsp. enterica serovar Heidelberg str. N18440 tRNA-Leu
  4247. Salmonella enterica subsp. enterica serovar Heidelberg str. N18453 tRNA-Leu
  4248. Salmonella enterica subsp. enterica serovar Heidelberg str. N189 tRNA-Leu
  4249. Salmonella enterica subsp. enterica serovar Heidelberg str. N19871 tRNA-Leu
  4250. Salmonella enterica subsp. enterica serovar Heidelberg str. N19992 tRNA-Leu
  4251. Salmonella enterica subsp. enterica serovar Heidelberg str. N20134 tRNA-Leu
  4252. Salmonella enterica subsp. enterica serovar Heidelberg str. N26457 tRNA-Leu
  4253. Salmonella enterica subsp. enterica serovar Heidelberg str. N29341 tRNA-Leu
  4254. Salmonella enterica subsp. enterica serovar Heidelberg str. N30678 tRNA-Leu
  4255. Salmonella enterica subsp. enterica serovar Heidelberg str. N418 tRNA-Leu
  4256. Salmonella enterica subsp. enterica serovar Heidelberg str. N4403 tRNA-Leu
  4257. Salmonella enterica subsp. enterica serovar Heidelberg str. N4496 tRNA-Leu
  4258. Salmonella enterica subsp. enterica serovar Heidelberg str. N4541 tRNA-Leu
  4259. Salmonella enterica subsp. enterica serovar Heidelberg str. N4630 tRNA-Leu
  4260. Salmonella enterica subsp. enterica serovar Heidelberg str. N653 tRNA-Leu
  4261. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-013193 tRNA-Leu
  4262. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-013312 tRNA-Leu
  4263. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-013343 tRNA-Leu
  4264. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-013374 tRNA-Leu
  4265. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-013988 tRNA-Leu
  4266. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-014316 tRNA-Leu
  4267. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-014319 tRNA-Leu
  4268. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-014588 tRNA-Leu
  4269. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA31 tRNA-Leu
  4270. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA32 tRNA-Leu
  4271. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA33 tRNA-Leu
  4272. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA35 tRNA-Leu
  4273. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA36 tRNA-Leu
  4274. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA37 tRNA-Leu
  4275. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA 39 tRNA-Leu
  4276. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA40 tRNA-Leu
  4277. Salmonella enterica subsp. enterica serovar Heidelberg str. SL476 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4278. Salmonella enterica subsp. enterica serovar Heidelberg tRNA-Leu
  4279. Salmonella enterica subsp. enterica serovar Herston tRNA-Leu
  4280. Salmonella enterica subsp. enterica serovar Hessarek tRNA-Leu
  4281. Salmonella enterica subsp. enterica serovar Hillingdon str. N1529-D3 tRNA-Leu
  4282. Salmonella enterica subsp. enterica serovar Hillingdon tRNA-Leu
  4283. Salmonella enterica subsp. enterica serovar Hindmarsh tRNA-Leu
  4284. Salmonella enterica subsp. enterica serovar Hissar tRNA-Leu
  4285. Salmonella enterica subsp. enterica serovar Holcomb tRNA-Leu
  4286. Salmonella enterica subsp. enterica serovar Horsham tRNA-Leu
  4287. Salmonella enterica subsp. enterica serovar Houston tRNA-Leu
  4288. Salmonella enterica subsp. enterica serovar Hull tRNA-Leu
  4289. Salmonella enterica subsp. enterica serovar Hvittingfoss str. A4-620 tRNA-Leu
  4290. Salmonella enterica subsp. enterica serovar Hvittingfoss str. SA20014981 tRNA-Leu
  4291. Salmonella enterica subsp. enterica serovar Hvittingfoss tRNA-Leu
  4292. Salmonella enterica subsp. enterica serovar Ibadan tRNA-Leu
  4293. Salmonella enterica subsp. enterica serovar Idikan tRNA-Leu
  4294. Salmonella enterica subsp. enterica serovar Ilala tRNA-Leu
  4295. Salmonella enterica subsp. enterica serovar Indiana str. ATCC 51959 tRNA-Leu
  4296. Salmonella enterica subsp. enterica serovar Indiana tRNA-Leu
  4297. Salmonella enterica subsp. enterica serovar Infantis str. 119944 tRNA-Leu
  4298. Salmonella enterica subsp. enterica serovar Infantis str. 335-3 tRNA-Leu
  4299. Salmonella enterica subsp. enterica serovar Infantis str. CFSAN000522 tRNA-Leu
  4300. Salmonella enterica subsp. enterica serovar Infantis str. CVM 17958 tRNA-Leu
  4301. Salmonella enterica subsp. enterica serovar Infantis str. CVM 22577 tRNA-Leu
  4302. Salmonella enterica subsp. enterica serovar Infantis str. CVM 22582 tRNA-Leu
  4303. Salmonella enterica subsp. enterica serovar Infantis str. CVM 23697 tRNA-Leu
  4304. Salmonella enterica subsp. enterica serovar Infantis str. CVM 23729 tRNA-Leu
  4305. Salmonella enterica subsp. enterica serovar Infantis str. CVM 818 tRNA-Leu
  4306. Salmonella enterica subsp. enterica serovar Infantis str. CVM N13139 tRNA-Leu
  4307. Salmonella enterica subsp. enterica serovar Infantis str. CVM N15228 tRNA-Leu
  4308. Salmonella enterica subsp. enterica serovar Infantis str. CVM N15773 tRNA-Leu
  4309. Salmonella enterica subsp. enterica serovar Infantis str. CVM N19983 tRNA-Leu
  4310. Salmonella enterica subsp. enterica serovar Infantis str. CVM N20078 tRNA-Leu
  4311. Salmonella enterica subsp. enterica serovar Infantis str. CVM N20272 tRNA-Leu
  4312. Salmonella enterica subsp. enterica serovar Infantis str. CVM N23532 tRNA-Leu
  4313. Salmonella enterica subsp. enterica serovar Infantis str. CVM N23771 tRNA-Leu
  4314. Salmonella enterica subsp. enterica serovar Infantis str. CVM N23791 tRNA-Leu
  4315. Salmonella enterica subsp. enterica serovar Infantis str. CVM N26093 tRNA-Leu
  4316. Salmonella enterica subsp. enterica serovar Infantis str. CVM N29304 tRNA-Leu
  4317. Salmonella enterica subsp. enterica serovar Infantis str. CVM N29379 tRNA-Leu
  4318. Salmonella enterica subsp. enterica serovar Infantis str. CVM N31594 tRNA-Leu
  4319. Salmonella enterica subsp. enterica serovar Infantis str. CVM N32590PS tRNA-Leu
  4320. Salmonella enterica subsp. enterica serovar Infantis str. CVM N32597PS tRNA-Leu
  4321. Salmonella enterica subsp. enterica serovar Infantis str. CVM N32599PS tRNA-Leu
  4322. Salmonella enterica subsp. enterica serovar Infantis str. CVM N32760 tRNA-Leu
  4323. Salmonella enterica subsp. enterica serovar Infantis str. CVM N34868PS tRNA-Leu
  4324. Salmonella enterica subsp. enterica serovar Infantis str. CVM N35495PS tRNA-Leu
  4325. Salmonella enterica subsp. enterica serovar Infantis str. CVM N35518 tRNA-Leu
  4326. Salmonella enterica subsp. enterica serovar Infantis str. CVM N38848 tRNA-Leu
  4327. Salmonella enterica subsp. enterica serovar Infantis str. CVM N41903 tRNA-Leu
  4328. Salmonella enterica subsp. enterica serovar Infantis str. CVM N42236 tRNA-Leu
  4329. Salmonella enterica subsp. enterica serovar Infantis str. CVM N42459 tRNA-Leu
  4330. Salmonella enterica subsp. enterica serovar Infantis str. SARB27 tRNA-Leu
  4331. Salmonella enterica subsp. enterica serovar Infantis tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4332. Salmonella enterica subsp. enterica serovar Inganda tRNA-Leu
  4333. Salmonella enterica subsp. enterica serovar Inverness str. ATCC 10720 tRNA-Leu
  4334. Salmonella enterica subsp. enterica serovar Inverness str. R8-3668 tRNA-Leu
  4335. Salmonella enterica subsp. enterica serovar Inverness tRNA-Leu
  4336. Salmonella enterica subsp. enterica serovar Irumu tRNA-Leu
  4337. Salmonella enterica subsp. enterica serovar Isangi tRNA-Leu
  4338. Salmonella enterica subsp. enterica serovar Istanbul tRNA-Leu
  4339. Salmonella enterica subsp. enterica serovar Itami str. SA20014991 tRNA-Leu
  4340. Salmonella enterica subsp. enterica serovar Itami tRNA-Leu
  4341. Salmonella enterica subsp. enterica serovar Ituri tRNA-Leu
  4342. Salmonella enterica subsp. enterica serovar Jangwani tRNA-Leu
  4343. Salmonella enterica subsp. enterica serovar Java tRNA-Leu
  4344. Salmonella enterica subsp. enterica serovar Javiana str. 10721 tRNA-Leu
  4345. Salmonella enterica subsp. enterica serovar Javiana str. ATCC BAA-1593 tRNA-Leu
  4346. Salmonella enterica subsp. enterica serovar Javiana str. CFSAN000904 tRNA-Leu
  4347. Salmonella enterica subsp. enterica serovar Javiana str. CFSAN000905 tRNA-Leu
  4348. Salmonella enterica subsp. enterica serovar Javiana str. CFSAN001992 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4349. Salmonella enterica subsp. enterica serovar Javiana str. PRS_2010_0720 tRNA-Leu
  4350. Salmonella enterica subsp. enterica serovar Javiana tRNA-Leu
  4351. Salmonella enterica subsp. enterica serovar Jedburgh tRNA-Leu
  4352. Salmonella enterica subsp. enterica serovar Jerusalem tRNA-Leu
  4353. Salmonella enterica subsp. enterica serovar Joal tRNA-Leu
  4354. Salmonella enterica subsp. enterica serovar Jodhpur tRNA-Leu
  4355. Salmonella enterica subsp. enterica serovar Johannesburg str. S5-703 tRNA-Leu
  4356. Salmonella enterica subsp. enterica serovar Johannesburg str. SA20025782 tRNA-Leu
  4357. Salmonella enterica subsp. enterica serovar Johannesburg str. ST203 tRNA-Leu
  4358. Salmonella enterica subsp. enterica serovar Johannesburg tRNA-Leu
  4359. Salmonella enterica subsp. enterica serovar Jubilee tRNA-Leu
  4360. Salmonella enterica subsp. enterica serovar Jukestown tRNA-Leu
  4361. Salmonella enterica subsp. enterica serovar Kaapstad tRNA-Leu
  4362. Salmonella enterica subsp. enterica serovar Kalamu tRNA-Leu
  4363. Salmonella enterica subsp. enterica serovar Kallo tRNA-Leu
  4364. Salmonella enterica subsp. enterica serovar Kambole tRNA-Leu
  4365. Salmonella enterica subsp. enterica serovar Kande tRNA-Leu
  4366. Salmonella enterica subsp. enterica serovar Kandla tRNA-Leu
  4367. Salmonella enterica subsp. enterica serovar Kaolack tRNA-Leu
  4368. Salmonella enterica subsp. enterica serovar Kapemba tRNA-Leu
  4369. Salmonella enterica subsp. enterica serovar Karamoja tRNA-Leu
  4370. Salmonella enterica subsp. enterica serovar Kasenyi tRNA-Leu
  4371. Salmonella enterica subsp. enterica serovar Kastrup tRNA-Leu
  4372. Salmonella enterica subsp. enterica serovar Kedougou tRNA-Leu
  4373. Salmonella enterica subsp. enterica serovar Kentucky str. 0253 tRNA-Leu
  4374. Salmonella enterica subsp. enterica serovar Kentucky str. 13562 tRNA-Leu
  4375. Salmonella enterica subsp. enterica serovar Kentucky str. 20793 tRNA-Leu
  4376. Salmonella enterica subsp. enterica serovar Kentucky str. 22694 tRNA-Leu
  4377. Salmonella enterica subsp. enterica serovar Kentucky str. 29166 tRNA-Leu
  4378. Salmonella enterica subsp. enterica serovar Kentucky str. 29439 tRNA-Leu
  4379. Salmonella enterica subsp. enterica serovar Kentucky str. 5349 tRNA-Leu
  4380. Salmonella enterica subsp. enterica serovar Kentucky str. ATCC 9263 tRNA-Leu
  4381. Salmonella enterica subsp. enterica serovar Kentucky str. N312 tRNA-Leu
  4382. Salmonella enterica subsp. enterica serovar Kentucky str. SA20030505 tRNA-Leu
  4383. Salmonella enterica subsp. enterica serovar Kentucky tRNA-Leu
  4384. Salmonella enterica subsp. enterica serovar Kenya tRNA-Leu
  4385. Salmonella enterica subsp. enterica serovar Kiambu tRNA-Leu
  4386. Salmonella enterica subsp. enterica serovar Kibi tRNA-Leu
  4387. Salmonella enterica subsp. enterica serovar Kibusi tRNA-Leu
  4388. Salmonella enterica subsp. enterica serovar Kimberley tRNA-Leu
  4389. Salmonella enterica subsp. enterica serovar Kimuenza tRNA-Leu
  4390. Salmonella enterica subsp. enterica serovar Kingabwa tRNA-Leu
  4391. Salmonella enterica subsp. enterica serovar Kingston tRNA-Leu
  4392. Salmonella enterica subsp. enterica serovar Kinondoni tRNA-Leu
  4393. Salmonella enterica subsp. enterica serovar Kinshasa tRNA-Leu
  4394. Salmonella enterica subsp. enterica serovar Kintambo tRNA-Leu
  4395. Salmonella enterica subsp. enterica serovar Kirkee tRNA-Leu
  4396. Salmonella enterica subsp. enterica serovar Kisangani tRNA-Leu
  4397. Salmonella enterica subsp. enterica serovar Kisarawe tRNA-Leu
  4398. Salmonella enterica subsp. enterica serovar Kisii tRNA-Leu
  4399. Salmonella enterica subsp. enterica serovar Koessen str. S-1501 tRNA-Leu
  4400. Salmonella enterica subsp. enterica serovar Koketime tRNA-Leu
  4401. Salmonella enterica subsp. enterica serovar Kokomlemle tRNA-Leu
  4402. Salmonella enterica subsp. enterica serovar Korlebu tRNA-Leu
  4403. Salmonella enterica subsp. enterica serovar Kottbus tRNA-Leu
  4404. Salmonella enterica subsp. enterica serovar Kouka tRNA-Leu
  4405. Salmonella enterica subsp. enterica serovar Krefeld str. SA20030536 tRNA-Leu
  4406. Salmonella enterica subsp. enterica serovar Krefeld tRNA-Leu
  4407. Salmonella enterica subsp. enterica serovar Kua tRNA-Leu
  4408. Salmonella enterica subsp. enterica serovar Kuessel tRNA-Leu
  4409. Salmonella enterica subsp. enterica serovar Kumasi tRNA-Leu
  4410. Salmonella enterica subsp. enterica serovar Kunzendorf tRNA-Leu
  4411. Salmonella enterica subsp. enterica serovar Lagos tRNA-Leu
  4412. Salmonella enterica subsp. enterica serovar Lanka tRNA-Leu
  4413. Salmonella enterica subsp. enterica serovar Lansing tRNA-Leu
  4414. Salmonella enterica subsp. enterica serovar Larochelle tRNA-Leu
  4415. Salmonella enterica subsp. enterica serovar Lattenkamp tRNA-Leu
  4416. Salmonella enterica subsp. enterica serovar Lawndale tRNA-Leu
  4417. Salmonella enterica subsp. enterica serovar Leatherhead tRNA-Leu
  4418. Salmonella enterica subsp. enterica serovar Leeuwarden tRNA-Leu
  4419. Salmonella enterica subsp. enterica serovar Legon tRNA-Leu
  4420. Salmonella enterica subsp. enterica serovar Leoben tRNA-Leu
  4421. Salmonella enterica subsp. enterica serovar Lerum tRNA-Leu
  4422. Salmonella enterica subsp. enterica serovar Lexington tRNA-Leu
  4423. Salmonella enterica subsp. enterica serovar Lexington var. 15+ tRNA-Leu
  4424. Salmonella enterica subsp. enterica serovar Lika tRNA-Leu
  4425. Salmonella enterica subsp. enterica serovar Lille tRNA-Leu
  4426. Salmonella enterica subsp. enterica serovar Limete tRNA-Leu
  4427. Salmonella enterica subsp. enterica serovar Lindern tRNA-Leu
  4428. Salmonella enterica subsp. enterica serovar Lingwala tRNA-Leu
  4429. Salmonella enterica subsp. enterica serovar Linton tRNA-Leu
  4430. Salmonella enterica subsp. enterica serovar Litchfield str. CFSAN001076 tRNA-Leu
  4431. Salmonella enterica subsp. enterica serovar Litchfield tRNA-Leu
  4432. Salmonella enterica subsp. enterica serovar Liverpool tRNA-Leu
  4433. Salmonella enterica subsp. enterica serovar Livingstone tRNA-Leu
  4434. Salmonella enterica subsp. enterica serovar Llandoff tRNA-Leu
  4435. Salmonella enterica subsp. enterica serovar Loanda tRNA-Leu
  4436. Salmonella enterica subsp. enterica serovar Lomalinda tRNA-Leu
  4437. Salmonella enterica subsp. enterica serovar Lome tRNA-Leu
  4438. Salmonella enterica subsp. enterica serovar London str. CFSAN001081 tRNA-Leu
  4439. Salmonella enterica subsp. enterica serovar London tRNA-Leu
  4440. Salmonella enterica subsp. enterica serovar Louisiana tRNA-Leu
  4441. Salmonella enterica subsp. enterica serovar Lubbock tRNA-Leu
  4442. Salmonella enterica subsp. enterica serovar Luciana tRNA-Leu
  4443. Salmonella enterica subsp. enterica serovar Luke tRNA-Leu
  4444. Salmonella enterica subsp. enterica serovar Macclesfield str. S-1643 tRNA-Leu
  4445. Salmonella enterica subsp. enterica serovar Madelia tRNA-Leu
  4446. Salmonella enterica subsp. enterica serovar Malaysia tRNA-Leu
  4447. Salmonella enterica subsp. enterica serovar Malstatt tRNA-Leu
  4448. Salmonella enterica subsp. enterica serovar Manchester str. ST278 tRNA-Leu
  4449. Salmonella enterica subsp. enterica serovar Manchester tRNA-Leu
  4450. Salmonella enterica subsp. enterica serovar Manhattan str. 111113 tRNA-Leu-CAA
  4451. Salmonella enterica subsp. enterica serovar Manhattan str. CFSAN001078 tRNA-Leu
  4452. Salmonella enterica subsp. enterica serovar Manhattan str. SA20034532 tRNA-Leu
  4453. Salmonella enterica subsp. enterica serovar Manhattan tRNA-Leu
  4454. Salmonella enterica subsp. enterica serovar Mapo tRNA-Leu
  4455. Salmonella enterica subsp. enterica serovar Maracaibo tRNA-Leu
  4456. Salmonella enterica subsp. enterica serovar Matadi tRNA-Leu
  4457. Salmonella enterica subsp. enterica serovar Matopeni tRNA-Leu
  4458. Salmonella enterica subsp. enterica serovar Mbandaka str. ATCC 51958 tRNA-Leu
  4459. Salmonella enterica subsp. enterica serovar Mbandaka tRNA-Leu
  4460. Salmonella enterica subsp. enterica serovar Meleagridis str. 0047 tRNA-Leu
  4461. Salmonella enterica subsp. enterica serovar Meleagridis tRNA-Leu
  4462. Salmonella enterica subsp. enterica serovar Memphis tRNA-Leu
  4463. Salmonella enterica subsp. enterica serovar Mendoza tRNA-Leu
  4464. Salmonella enterica subsp. enterica serovar Menston tRNA-Leu
  4465. Salmonella enterica subsp. enterica serovar Mesbit tRNA-Leu
  4466. Salmonella enterica subsp. enterica serovar Mgulani tRNA-Leu
  4467. Salmonella enterica subsp. enterica serovar Miami str. 1923 tRNA-Leu
  4468. Salmonella enterica subsp. enterica serovar Miami str. CFSAN000579 tRNA-Leu
  4469. Salmonella enterica subsp. enterica serovar Miami tRNA-Leu
  4470. Salmonella enterica subsp. enterica serovar Michigan tRNA-Leu
  4471. Salmonella enterica subsp. enterica serovar Middlesbrough tRNA-Leu
  4472. Salmonella enterica subsp. enterica serovar Midway tRNA-Leu
  4473. Salmonella enterica subsp. enterica serovar Mikawasima tRNA-Leu
  4474. Salmonella enterica subsp. enterica serovar Millesi tRNA-Leu
  4475. Salmonella enterica subsp. enterica serovar Milwaukee str. SA19950795 tRNA-Leu
  4476. Salmonella enterica subsp. enterica serovar Minneapolis tRNA-Leu
  4477. Salmonella enterica subsp. enterica serovar Minnesota str. A4-603 tRNA-Leu
  4478. Salmonella enterica subsp. enterica serovar Minnesota str. ATCC 49284 tRNA-Leu
  4479. Salmonella enterica subsp. enterica serovar Minnesota tRNA-Leu
  4480. Salmonella enterica subsp. enterica serovar Mishmarhaemek tRNA-Leu
  4481. Salmonella enterica subsp. enterica serovar Mississippi str. A4-633 tRNA-Leu
  4482. Salmonella enterica subsp. enterica serovar Mississippi tRNA-Leu
  4483. Salmonella enterica subsp. enterica serovar Moero tRNA-Leu
  4484. Salmonella enterica subsp. enterica serovar Mokola tRNA-Leu
  4485. Salmonella enterica subsp. enterica serovar Molade tRNA-Leu
  4486. Salmonella enterica subsp. enterica serovar Monophasic tRNA-Leu
  4487. Salmonella enterica subsp. enterica serovar Monschaui tRNA-Leu
  4488. Salmonella enterica subsp. enterica serovar Montevideo str. 0263 tRNA-Leu
  4489. Salmonella enterica subsp. enterica serovar Montevideo str. 19N tRNA-Leu
  4490. Salmonella enterica subsp. enterica serovar Montevideo str. 2009083312 tRNA-Leu
  4491. Salmonella enterica subsp. enterica serovar Montevideo str. 2009085258 tRNA-Leu
  4492. Salmonella enterica subsp. enterica serovar Montevideo str. 29N tRNA-Leu
  4493. Salmonella enterica subsp. enterica serovar Montevideo str. 315731156 tRNA-Leu
  4494. Salmonella enterica subsp. enterica serovar Montevideo str. 315996572 tRNA-Leu
  4495. Salmonella enterica subsp. enterica serovar Montevideo str. 316111868 tRNA-Leu
  4496. Salmonella enterica subsp. enterica serovar Montevideo str. 366867 tRNA-Leu
  4497. Salmonella enterica subsp. enterica serovar Montevideo str. 413180 tRNA-Leu
  4498. Salmonella enterica subsp. enterica serovar Montevideo str. 414877 tRNA-Leu
  4499. Salmonella enterica subsp. enterica serovar Montevideo str. 42N tRNA-Leu
  4500. Salmonella enterica subsp. enterica serovar Montevideo str. 4441 H tRNA-Leu
  4501. Salmonella enterica subsp. enterica serovar Montevideo str. 446600 tRNA-Leu
  4502. Salmonella enterica subsp. enterica serovar Montevideo str. 468879-1 tRNA-Leu
  4503. Salmonella enterica subsp. enterica serovar Montevideo str. 495297-1 tRNA-Leu
  4504. Salmonella enterica subsp. enterica serovar Montevideo str. 495297-3 tRNA-Leu
  4505. Salmonella enterica subsp. enterica serovar Montevideo str. 495297-4 tRNA-Leu
  4506. Salmonella enterica subsp. enterica serovar Montevideo str. 507440-20 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4507. Salmonella enterica subsp. enterica serovar Montevideo str. 515920-1 tRNA-Leu
  4508. Salmonella enterica subsp. enterica serovar Montevideo str. 515920-2 tRNA-Leu
  4509. Salmonella enterica subsp. enterica serovar Montevideo str. 531954 tRNA-Leu
  4510. Salmonella enterica subsp. enterica serovar Montevideo str. 556150-1 tRNA-Leu
  4511. Salmonella enterica subsp. enterica serovar Montevideo str. 556152 tRNA-Leu
  4512. Salmonella enterica subsp. enterica serovar Montevideo str. 609458-1 tRNA-Leu
  4513. Salmonella enterica subsp. enterica serovar Montevideo str. 609458-2 tRNA-Leu
  4514. Salmonella enterica subsp. enterica serovar Montevideo str. 609460 tRNA-Leu
  4515. Salmonella enterica subsp. enterica serovar Montevideo str. 644129 tRNA-Leu
  4516. Salmonella enterica subsp. enterica serovar Montevideo str. 80959-06 tRNA-Leu
  4517. Salmonella enterica subsp. enterica serovar Montevideo str. 81038-01 tRNA-Leu
  4518. Salmonella enterica subsp. enterica serovar Montevideo str. 8387 tRNA-Leu
  4519. Salmonella enterica subsp. enterica serovar Montevideo str. ATCC BAA710 tRNA-Leu
  4520. Salmonella enterica subsp. enterica serovar Montevideo str. CASC_09SCPH15965 tRNA-Leu
  4521. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 07-0954 tRNA-Leu
  4522. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 08-1942 tRNA-Leu
  4523. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2009K-0792 tRNA-Leu
  4524. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2010K-0257 tRNA-Leu
  4525. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2011K-1674 tRNA-Leu
  4526. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2012K-1544 tRNA-Leu
  4527. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2013K-0218 tRNA-Leu
  4528. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 86-0391 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4529. Salmonella enterica subsp. enterica serovar Montevideo str. CFSAN004346 tRNA-Leu
  4530. Salmonella enterica subsp. enterica serovar Montevideo str. CT_02035278 tRNA-Leu
  4531. Salmonella enterica subsp. enterica serovar Montevideo str. CT_02035318 tRNA-Leu
  4532. Salmonella enterica subsp. enterica serovar Montevideo str. CT_02035320 tRNA-Leu
  4533. Salmonella enterica subsp. enterica serovar Montevideo str. CT_02035321 tRNA-Leu
  4534. Salmonella enterica subsp. enterica serovar Montevideo str. CT_02035327 tRNA-Leu
  4535. Salmonella enterica subsp. enterica serovar Montevideo str. FSL_R8-2868 tRNA-Leu
  4536. Salmonella enterica subsp. enterica serovar Montevideo str. FSL_R8-4673 tRNA-Leu
  4537. Salmonella enterica subsp. enterica serovar Montevideo str. FSL_R8-4843 tRNA-Leu
  4538. Salmonella enterica subsp. enterica serovar Montevideo str. FSL_R8-4916 tRNA-Leu
  4539. Salmonella enterica subsp. enterica serovar Montevideo str. FSL_R8-4922 tRNA-Leu
  4540. Salmonella enterica subsp. enterica serovar Montevideo str. FVM_628064 tRNA-Leu
  4541. Salmonella enterica subsp. enterica serovar Montevideo str. IA_2009159199 tRNA-Leu
  4542. Salmonella enterica subsp. enterica serovar Montevideo str. IA_2010008282 tRNA-Leu
  4543. Salmonella enterica subsp. enterica serovar Montevideo str. IA_2010008283 tRNA-Leu
  4544. Salmonella enterica subsp. enterica serovar Montevideo str. IA_2010008284 tRNA-Leu
  4545. Salmonella enterica subsp. enterica serovar Montevideo str. IA_2010008285 tRNA-Leu
  4546. Salmonella enterica subsp. enterica serovar Montevideo str. IA_2010008286 tRNA-Leu
  4547. Salmonella enterica subsp. enterica serovar Montevideo str. IA_2010008287 tRNA-Leu
  4548. Salmonella enterica subsp. enterica serovar Montevideo str. LQC 10 tRNA-Leu
  4549. Salmonella enterica subsp. enterica serovar Montevideo str. MB101509-0077 tRNA-Leu
  4550. Salmonella enterica subsp. enterica serovar Montevideo str. MB102109-0047 tRNA-Leu
  4551. Salmonella enterica subsp. enterica serovar Montevideo str. MB110209-0055 tRNA-Leu
  4552. Salmonella enterica subsp. enterica serovar Montevideo str. MB111609-0052 tRNA-Leu
  4553. Salmonella enterica subsp. enterica serovar Montevideo str. MD_MDA09249507 tRNA-Leu
  4554. Salmonella enterica subsp. enterica serovar Montevideo str. N19965 tRNA-Leu
  4555. Salmonella enterica subsp. enterica serovar Montevideo str. NC_MB110209-0054 tRNA-Leu
  4556. Salmonella enterica subsp. enterica serovar Montevideo str. OH_2009072675 tRNA-Leu
  4557. Salmonella enterica subsp. enterica serovar Montevideo str. S5-403 tRNA-Leu
  4558. Salmonella enterica subsp. enterica serovar Montevideo str. SARB30 tRNA-Leu
  4559. Salmonella enterica subsp. enterica serovar Montevideo str. SARB31 tRNA-Leu
  4560. Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1900 tRNA-Leu
  4561. Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1901 tRNA-Leu
  4562. Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1903 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4563. Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1904 tRNA-Leu
  4564. Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1912 tRNA-Leu
  4565. Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1913 tRNA-Leu
  4566. Salmonella enterica subsp. enterica serovar Montevideo tRNA-Leu
  4567. Salmonella enterica subsp. enterica serovar Morehead tRNA-Leu
  4568. Salmonella enterica subsp. enterica serovar Moroto tRNA-Leu
  4569. Salmonella enterica subsp. enterica serovar Moscow str. S-1843 tRNA-Leu
  4570. Salmonella enterica subsp. enterica serovar Moscow str. SA20061414 tRNA-Leu
  4571. Salmonella enterica subsp. enterica serovar Moscow tRNA-Leu
  4572. Salmonella enterica subsp. enterica serovar Mountpleasant tRNA-Leu
  4573. Salmonella enterica subsp. enterica serovar Muenchen str. ATCC 8388 tRNA-Leu
  4574. Salmonella enterica subsp. enterica serovar Muenchen str. baa1594 tRNA-Leu
  4575. Salmonella enterica subsp. enterica serovar Muenchen str. baa1674 tRNA-Leu
  4576. Salmonella enterica subsp. enterica serovar Muenchen str. CFSAN000585 tRNA-Leu
  4577. Salmonella enterica subsp. enterica serovar Muenchen str. CFSAN000591 tRNA-Leu
  4578. Salmonella enterica subsp. enterica serovar Muenchen str. CFSAN000593 tRNA-Leu
  4579. Salmonella enterica subsp. enterica serovar Muenchen str. CFSAN000595 tRNA-Leu
  4580. Salmonella enterica subsp. enterica serovar Muenchen str. CFSAN000596 tRNA-Leu
  4581. Salmonella enterica subsp. enterica serovar Muenchen str. RKS4129 tRNA-Leu
  4582. Salmonella enterica subsp. enterica serovar Muenchen tRNA-Leu
  4583. Salmonella enterica subsp. enterica serovar Muenster str. 0315 tRNA-Leu
  4584. Salmonella enterica subsp. enterica serovar Muenster str. 420 tRNA-Leu
  4585. Salmonella enterica subsp. enterica serovar Muenster str. 660 tRNA-Leu
  4586. Salmonella enterica subsp. enterica serovar Muenster str. CFSAN004344 tRNA-Leu
  4587. Salmonella enterica subsp. enterica serovar Muenster tRNA-Leu
  4588. Salmonella enterica subsp. enterica serovar Nagoya tRNA-Leu
  4589. Salmonella enterica subsp. enterica serovar Namur str. 05-2929 tRNA-Leu
  4590. Salmonella enterica subsp. enterica serovar Napoli tRNA-Leu
  4591. Salmonella enterica subsp. enterica serovar Nchanga str. CFSAN001091 tRNA-Leu
  4592. Salmonella enterica subsp. enterica serovar Nchanga str. CFSAN001092 tRNA-Leu
  4593. Salmonella enterica subsp. enterica serovar Nchanga tRNA-Leu
  4594. Salmonella enterica subsp. enterica serovar Ndolo tRNA-Leu
  4595. Salmonella enterica subsp. enterica serovar Nessziona tRNA-Leu
  4596. Salmonella enterica subsp. enterica serovar Neukoelln tRNA-Leu
  4597. Salmonella enterica subsp. enterica serovar Neunkirchen tRNA-Leu
  4598. Salmonella enterica subsp. enterica serovar Newbrunswick tRNA-Leu
  4599. Salmonella enterica subsp. enterica serovar Newington tRNA-Leu
  4600. Salmonella enterica subsp. enterica serovar Newlands tRNA-Leu
  4601. Salmonella enterica subsp. enterica serovar Newmexico tRNA-Leu
  4602. Salmonella enterica subsp. enterica serovar Newport str. 0267 tRNA-Leu
  4603. Salmonella enterica subsp. enterica serovar Newport str. #11-2 tRNA-Leu
  4604. Salmonella enterica subsp. enterica serovar Newport str. #11-3 tRNA-Leu
  4605. Salmonella enterica subsp. enterica serovar Newport str. #11-4 tRNA-Leu
  4606. Salmonella enterica subsp. enterica serovar Newport str. 36796 tRNA-Leu
  4607. Salmonella enterica subsp. enterica serovar Newport str. 36799 tRNA-Leu
  4608. Salmonella enterica subsp. enterica serovar Newport str. 36801 tRNA-Leu
  4609. Salmonella enterica subsp. enterica serovar Newport str. 36802 tRNA-Leu
  4610. Salmonella enterica subsp. enterica serovar Newport str. 36803 tRNA-Leu
  4611. Salmonella enterica subsp. enterica serovar Newport str. 36804 tRNA-Leu
  4612. Salmonella enterica subsp. enterica serovar Newport str. 36805 tRNA-Leu
  4613. Salmonella enterica subsp. enterica serovar Newport str. 36807 tRNA-Leu
  4614. Salmonella enterica subsp. enterica serovar Newport str. 637564_17 tRNA-Leu
  4615. Salmonella enterica subsp. enterica serovar Newport str. A182RVB tRNA-Leu
  4616. Salmonella enterica subsp. enterica serovar Newport str. A-211-RVH tRNA-Leu
  4617. Salmonella enterica subsp. enterica serovar Newport str. A-211-TTX tRNA-Leu
  4618. Salmonella enterica subsp. enterica serovar Newport str. CDC 2009K-1331 tRNA-Leu
  4619. Salmonella enterica subsp. enterica serovar Newport str. CDC 2010K-2159 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4620. Salmonella enterica subsp. enterica serovar Newport str. CDC 2012K-0663 tRNA-Leu
  4621. Salmonella enterica subsp. enterica serovar Newport str. CDC 2012K-0938 tRNA-Leu
  4622. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000597 tRNA-Leu
  4623. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000598 tRNA-Leu
  4624. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000599 tRNA-Leu
  4625. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000826 tRNA-Leu
  4626. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000827 tRNA-Leu
  4627. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000828 tRNA-Leu
  4628. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000829 tRNA-Leu
  4629. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000830 tRNA-Leu
  4630. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000831 tRNA-Leu
  4631. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000832 tRNA-Leu
  4632. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000833 tRNA-Leu
  4633. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000834 tRNA-Leu
  4634. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000835 tRNA-Leu
  4635. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000837 tRNA-Leu
  4636. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000901 tRNA-Leu
  4637. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001633 tRNA-Leu
  4638. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001634 tRNA-Leu
  4639. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001635 tRNA-Leu
  4640. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001636 tRNA-Leu
  4641. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001637 tRNA-Leu
  4642. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001638 tRNA-Leu
  4643. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001639 tRNA-Leu
  4644. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001640 tRNA-Leu
  4645. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001641 tRNA-Leu
  4646. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001642 tRNA-Leu
  4647. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001643 tRNA-Leu
  4648. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001644 tRNA-Leu
  4649. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001645 tRNA-Leu
  4650. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001646 tRNA-Leu
  4651. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001647 tRNA-Leu
  4652. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001648 tRNA-Leu
  4653. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001661 tRNA-Leu
  4654. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001889 tRNA-Leu
  4655. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001890 tRNA-Leu
  4656. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001894 tRNA-Leu
  4657. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001895 tRNA-Leu
  4658. Salmonella enterica subsp. enterica serovar Newport str. CVM17619 tRNA-Leu
  4659. Salmonella enterica subsp. enterica serovar Newport str. CVM18000 tRNA-Leu
  4660. Salmonella enterica subsp. enterica serovar Newport str. CVM18005 tRNA-Leu
  4661. Salmonella enterica subsp. enterica serovar Newport str. CVM 19443 tRNA-Leu
  4662. Salmonella enterica subsp. enterica serovar Newport str. CVM 19447 tRNA-Leu
  4663. Salmonella enterica subsp. enterica serovar Newport str. CVM 19449 tRNA-Leu
  4664. Salmonella enterica subsp. enterica serovar Newport str. CVM 19470 tRNA-Leu
  4665. Salmonella enterica subsp. enterica serovar Newport str. CVM 19536 tRNA-Leu
  4666. Salmonella enterica subsp. enterica serovar Newport str. CVM 19567 tRNA-Leu
  4667. Salmonella enterica subsp. enterica serovar Newport str. CVM 19593 tRNA-Leu
  4668. Salmonella enterica subsp. enterica serovar Newport str. CVM20775 tRNA-Leu
  4669. Salmonella enterica subsp. enterica serovar Newport str. CVM20776 tRNA-Leu
  4670. Salmonella enterica subsp. enterica serovar Newport str. CVM21537 tRNA-Leu
  4671. Salmonella enterica subsp. enterica serovar Newport str. CVM 21538 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4672. Salmonella enterica subsp. enterica serovar Newport str. CVM 21539 tRNA-Leu
  4673. Salmonella enterica subsp. enterica serovar Newport str. CVM 21550 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4674. Salmonella enterica subsp. enterica serovar Newport str. CVM 21554 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4675. Salmonella enterica subsp. enterica serovar Newport str. CVM 21559 tRNA-Leu
  4676. Salmonella enterica subsp. enterica serovar Newport str. CVM 22425 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4677. Salmonella enterica subsp. enterica serovar Newport str. CVM22443 tRNA-Leu
  4678. Salmonella enterica subsp. enterica serovar Newport str. CVM 22462 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4679. Salmonella enterica subsp. enterica serovar Newport str. CVM 22513 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4680. Salmonella enterica subsp. enterica serovar Newport str. CVM22697 tRNA-Leu
  4681. Salmonella enterica subsp. enterica serovar Newport str. CVM22699 tRNA-Leu
  4682. Salmonella enterica subsp. enterica serovar Newport str. CVM22707 tRNA-Leu
  4683. Salmonella enterica subsp. enterica serovar Newport str. CVM24403 tRNA-Leu
  4684. Salmonella enterica subsp. enterica serovar Newport str. CVM30171 tRNA-Leu
  4685. Salmonella enterica subsp. enterica serovar Newport str. CVM 33953 tRNA-Leu
  4686. Salmonella enterica subsp. enterica serovar Newport str. CVM34519 tRNA-Leu
  4687. Salmonella enterica subsp. enterica serovar Newport str. CVM 35185 tRNA-Leu
  4688. Salmonella enterica subsp. enterica serovar Newport str. CVM 35188 tRNA-Leu
  4689. Salmonella enterica subsp. enterica serovar Newport str. CVM 35199 tRNA-Leu
  4690. Salmonella enterica subsp. enterica serovar Newport str. CVM 35202 tRNA-Leu
  4691. Salmonella enterica subsp. enterica serovar Newport str. CVM 37978 tRNA-Leu
  4692. Salmonella enterica subsp. enterica serovar Newport str. CVM 4176 tRNA-Leu
  4693. Salmonella enterica subsp. enterica serovar Newport str. CVM75_1280 tRNA-Leu
  4694. Salmonella enterica subsp. enterica serovar Newport str. CVM79_1357 tRNA-Leu
  4695. Salmonella enterica subsp. enterica serovar Newport str. CVM79_1594 tRNA-Leu
  4696. Salmonella enterica subsp. enterica serovar Newport str. CVM80_2288 tRNA-Leu
  4697. Salmonella enterica subsp. enterica serovar Newport str. CVM N1543 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4698. Salmonella enterica subsp. enterica serovar Newport str. CVM N18486 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4699. Salmonella enterica subsp. enterica serovar Newport str. DC_10-446 tRNA-Leu
  4700. Salmonella enterica subsp. enterica serovar Newport str. DC_10-449 tRNA-Leu
  4701. Salmonella enterica subsp. enterica serovar Newport str. DC_10-450 tRNA-Leu
  4702. Salmonella enterica subsp. enterica serovar Newport str. Henan_3 tRNA-Leu
  4703. Salmonella enterica subsp. enterica serovar Newport str. JS09102 tRNA-Leu
  4704. Salmonella enterica subsp. enterica serovar Newport str. JY-221A-RVX tRNA-Leu
  4705. Salmonella enterica subsp. enterica serovar Newport str. JY-223A-RVX tRNA-Leu
  4706. Salmonella enterica subsp. enterica serovar Newport str. L0167 tRNA-Leu
  4707. Salmonella enterica subsp. enterica serovar Newport str. Levine 15 tRNA-Leu
  4708. Salmonella enterica subsp. enterica serovar Newport str. Levine 1 tRNA-Leu
  4709. Salmonella enterica subsp. enterica serovar Newport str. MA_10EN1469 tRNA-Leu
  4710. Salmonella enterica subsp. enterica serovar Newport str. PL01 tRNA-Leu
  4711. Salmonella enterica subsp. enterica serovar Newport str. Pond080-2TTA tRNA-Leu
  4712. Salmonella enterica subsp. enterica serovar Newport str. PRS_2010_0624 tRNA-Leu
  4713. Salmonella enterica subsp. enterica serovar Newport str. RI_10P068 tRNA-Leu
  4714. Salmonella enterica subsp. enterica serovar Newport str. RI_10P069 tRNA-Leu
  4715. Salmonella enterica subsp. enterica serovar Newport str. RI_10P078 tRNA-Leu
  4716. Salmonella enterica subsp. enterica serovar Newport str. RI_10P079 tRNA-Leu
  4717. Salmonella enterica subsp. enterica serovar Newport str. S103RVX tRNA-Leu
  4718. Salmonella enterica subsp. enterica serovar Newport str. S-38A-RVX tRNA-Leu
  4719. Salmonella enterica subsp. enterica serovar Newport str. S-49A-RVX tRNA-Leu
  4720. Salmonella enterica subsp. enterica serovar Newport str. SH111077 tRNA-Leu
  4721. Salmonella enterica subsp. enterica serovar Newport str. Shandong_3 tRNA-Leu
  4722. Salmonella enterica subsp. enterica serovar Newport str. SHSN001 tRNA-Leu
  4723. Salmonella enterica subsp. enterica serovar Newport str. SHSN002 tRNA-Leu
  4724. Salmonella enterica subsp. enterica serovar Newport str. SHSN003 tRNA-Leu
  4725. Salmonella enterica subsp. enterica serovar Newport str. SHSN004 tRNA-Leu
  4726. Salmonella enterica subsp. enterica serovar Newport str. SHSN005 tRNA-Leu
  4727. Salmonella enterica subsp. enterica serovar Newport str. SHSN007 tRNA-Leu
  4728. Salmonella enterica subsp. enterica serovar Newport str. SHSN008 tRNA-Leu
  4729. Salmonella enterica subsp. enterica serovar Newport str. SHSN010 tRNA-Leu
  4730. Salmonella enterica subsp. enterica serovar Newport str. SHSN011 tRNA-Leu
  4731. Salmonella enterica subsp. enterica serovar Newport str. SHSN012 tRNA-Leu
  4732. Salmonella enterica subsp. enterica serovar Newport str. SHSN013 tRNA-Leu
  4733. Salmonella enterica subsp. enterica serovar Newport str. SHSN014 tRNA-Leu
  4734. Salmonella enterica subsp. enterica serovar Newport str. SL254 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4735. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1923 tRNA-Leu
  4736. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1924 tRNA-Leu
  4737. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1925 tRNA-Leu
  4738. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1926 tRNA-Leu
  4739. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1927 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4740. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1928 tRNA-Leu
  4741. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1929 tRNA-Leu
  4742. Salmonella enterica subsp. enterica serovar Newport str. USMARC-S3124.1 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4743. Salmonella enterica subsp. enterica serovar Newport str. VA_R100506907 tRNA-Leu
  4744. Salmonella enterica subsp. enterica serovar Newport str. VA_R100512570 tRNA-Leu
  4745. Salmonella enterica subsp. enterica serovar Newport str. VA_R100512572 tRNA-Leu
  4746. Salmonella enterica subsp. enterica serovar Newport str. VA_R100804798 tRNA-Leu
  4747. Salmonella enterica subsp. enterica serovar Newport str. VA_R100808502 tRNA-Leu
  4748. Salmonella enterica subsp. enterica serovar Newport str. WA_14881 tRNA-Leu
  4749. Salmonella enterica subsp. enterica serovar Newport str. WA_14882 tRNA-Leu
  4750. Salmonella enterica subsp. enterica serovar Newport str. WA_14885 tRNA-Leu
  4751. Salmonella enterica subsp. enterica serovar Newport str. WA_14900 tRNA-Leu
  4752. Salmonella enterica subsp. enterica serovar Newport tRNA-Leu
  4753. Salmonella enterica subsp. enterica serovar Newyork tRNA-Leu
  4754. Salmonella enterica subsp. enterica serovar Ngili tRNA-Leu
  4755. Salmonella enterica subsp. enterica serovar Nigeria tRNA-Leu
  4756. Salmonella enterica subsp. enterica serovar Nijmegen tRNA-Leu
  4757. Salmonella enterica subsp. enterica serovar Nima tRNA-Leu
  4758. Salmonella enterica subsp. enterica serovar Nitra tRNA-Leu
  4759. Salmonella enterica subsp. enterica serovar Norwich str. CFSAN001077 tRNA-Leu
  4760. Salmonella enterica subsp. enterica serovar Norwich tRNA-Leu
  4761. Salmonella enterica subsp. enterica serovar Nottingham tRNA-Leu
  4762. Salmonella enterica subsp. enterica serovar Noya tRNA-Leu
  4763. Salmonella enterica subsp. enterica serovar Nyanza tRNA-Leu
  4764. Salmonella enterica subsp. enterica serovar Oakland tRNA-Leu
  4765. Salmonella enterica subsp. enterica serovar Obogu tRNA-Leu
  4766. Salmonella enterica subsp. enterica serovar Odozi tRNA-Leu
  4767. Salmonella enterica subsp. enterica serovar Offa tRNA-Leu
  4768. Salmonella enterica subsp. enterica serovar Ohio str. CFSAN001079 tRNA-Leu
  4769. Salmonella enterica subsp. enterica serovar Ohio tRNA-Leu
  4770. Salmonella enterica subsp. enterica serovar Okatie tRNA-Leu
  4771. Salmonella enterica subsp. enterica serovar Olten tRNA-Leu
  4772. Salmonella enterica subsp. enterica serovar Omderman tRNA-Leu
  4773. Salmonella enterica subsp. enterica serovar Omuna tRNA-Leu
  4774. Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 tRNA-Leu
  4775. Salmonella enterica subsp. enterica serovar Onderstepoort tRNA-Leu
  4776. Salmonella enterica subsp. enterica serovar Onireke tRNA-Leu
  4777. Salmonella enterica subsp. enterica serovar Oranienburg tRNA-Leu
  4778. Salmonella enterica subsp. enterica serovar Ordonez tRNA-Leu
  4779. Salmonella enterica subsp. enterica serovar Orientalis tRNA-Leu
  4780. Salmonella enterica subsp. enterica serovar Orion tRNA-Leu
  4781. Salmonella enterica subsp. enterica serovar O Rough:a:- tRNA-Leu
  4782. Salmonella enterica subsp. enterica serovar O rough tRNA-Leu
  4783. Salmonella enterica subsp. enterica serovar Oskarshamn tRNA-Leu
  4784. Salmonella enterica subsp. enterica serovar Oslo tRNA-Leu
  4785. Salmonella enterica subsp. enterica serovar Othmarschen tRNA-Leu
  4786. Salmonella enterica subsp. enterica serovar Ouagadougou tRNA-Leu
  4787. Salmonella enterica subsp. enterica serovar Ouakam str. SA20034636 tRNA-Leu
  4788. Salmonella enterica subsp. enterica serovar Ouakam tRNA-Leu
  4789. Salmonella enterica subsp. enterica serovar Oudwijk tRNA-Leu
  4790. Salmonella enterica subsp. enterica serovar Overschie tRNA-Leu
  4791. Salmonella enterica subsp. enterica serovar Pakistan tRNA-Leu
  4792. Salmonella enterica subsp. enterica serovar Panama str. ATCC 7378 tRNA-Leu
  4793. Salmonella enterica subsp. enterica serovar Panama str. CFSAN000600 tRNA-Leu
  4794. Salmonella enterica subsp. enterica serovar Panama str. CFSAN000601 tRNA-Leu
  4795. Salmonella enterica subsp. enterica serovar Panama str. CFSAN000602 tRNA-Leu
  4796. Salmonella enterica subsp. enterica serovar Panama str. SA20030878 tRNA-Leu
  4797. Salmonella enterica subsp. enterica serovar Panama tRNA-Leu
  4798. Salmonella enterica subsp. enterica serovar Papuana tRNA-Leu
  4799. Salmonella enterica subsp. enterica serovar Paratyphi A str. AKU_12601 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4800. Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4801. Salmonella enterica subsp. enterica serovar Paratyphi A str. SA19950809 tRNA-Leu
  4802. Salmonella enterica subsp. enterica serovar Paratyphi A tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4803. Salmonella enterica subsp. enterica serovar Paratyphi B str. ATCC 10719 tRNA-Leu
  4804. Salmonella enterica subsp. enterica serovar Paratyphi B str. ATCC 19940 tRNA-Leu
  4805. Salmonella enterica subsp. enterica serovar Paratyphi B str. ATCC 51962 tRNA-Leu
  4806. Salmonella enterica subsp. enterica serovar Paratyphi B str. ATCC 8759 tRNA-Leu
  4807. Salmonella enterica subsp. enterica serovar Paratyphi B str. ATCC BAA-1585 tRNA-Leu
  4808. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000527 tRNA-Leu
  4809. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000532 tRNA-Leu
  4810. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000536 tRNA-Leu
  4811. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000540 tRNA-Leu
  4812. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000541 tRNA-Leu
  4813. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000542 tRNA-Leu
  4814. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000545 tRNA-Leu
  4815. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000547 tRNA-Leu
  4816. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000548 tRNA-Leu
  4817. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000549 tRNA-Leu
  4818. Salmonella enterica subsp. enterica serovar Paratyphi B str. SARA42 tRNA-Leu
  4819. Salmonella enterica subsp. enterica serovar Paratyphi B str. SARA56 tRNA-Leu
  4820. Salmonella enterica subsp. enterica serovar Paratyphi B str. SARA61 tRNA-Leu
  4821. Salmonella enterica subsp. enterica serovar Paratyphi B str. SARA62 tRNA-Leu
  4822. Salmonella enterica subsp. enterica serovar Paratyphi B str. SPB7 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4823. Salmonella enterica subsp. enterica serovar Paratyphi B tRNA-Leu
  4824. Salmonella enterica subsp. enterica serovar Paratyphi C str. CFSAN000603 tRNA-Leu
  4825. Salmonella enterica subsp. enterica serovar Paratyphi C str. CFSAN000604 tRNA-Leu
  4826. Salmonella enterica subsp. enterica serovar Paratyphi C str. RKS4594 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4827. Salmonella enterica subsp. enterica serovar Paratyphi C tRNA-Leu
  4828. Salmonella enterica subsp. enterica serovar Parkroyal tRNA-Leu
  4829. Salmonella enterica subsp. enterica serovar Pasing tRNA-Leu
  4830. Salmonella enterica subsp. enterica serovar Penarth tRNA-Leu
  4831. Salmonella enterica subsp. enterica serovar Pensacola tRNA-Leu
  4832. Salmonella enterica subsp. enterica serovar Plymouth tRNA-Leu
  4833. Salmonella enterica subsp. enterica serovar Poano tRNA-Leu
  4834. Salmonella enterica subsp. enterica serovar Pomona str. ATCC 10729 tRNA-Leu
  4835. Salmonella enterica subsp. enterica serovar Pomona tRNA-Leu
  4836. Salmonella enterica subsp. enterica serovar Poona str. ATCC BAA-1673 tRNA-Leu
  4837. Salmonella enterica subsp. enterica serovar Poona tRNA-Leu
  4838. Salmonella enterica subsp. enterica serovar Potsdam tRNA-Leu
  4839. Salmonella enterica subsp. enterica serovar Praha tRNA-Leu
  4840. Salmonella enterica subsp. enterica serovar Pretoria tRNA-Leu
  4841. Salmonella enterica subsp. enterica serovar Pullorum str. 13036 tRNA-Leu
  4842. Salmonella enterica subsp. enterica serovar Pullorum str. 19945 tRNA-Leu
  4843. Salmonella enterica subsp. enterica serovar Pullorum str. ATCC 9120 tRNA-Leu
  4844. Salmonella enterica subsp. enterica serovar Pullorum str. CFSAN000606 tRNA-Leu
  4845. Salmonella enterica subsp. enterica serovar Pullorum str. S06004 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4846. Salmonella enterica subsp. enterica serovar Pullorum tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4847. Salmonella enterica subsp. enterica serovar Putten tRNA-Leu
  4848. Salmonella enterica subsp. enterica serovar Quebec str. S-1267 tRNA-Leu
  4849. Salmonella enterica subsp. enterica serovar -:r:1,5 tRNA-Leu
  4850. Salmonella enterica subsp. enterica serovar Ramatgan tRNA-Leu
  4851. Salmonella enterica subsp. enterica serovar Rauform tRNA-Leu
  4852. Salmonella enterica subsp. enterica serovar Reading tRNA-Leu
  4853. Salmonella enterica subsp. enterica serovar Redba tRNA-Leu
  4854. Salmonella enterica subsp. enterica serovar Redlands tRNA-Leu
  4855. Salmonella enterica subsp. enterica serovar Remiremont tRNA-Leu
  4856. Salmonella enterica subsp. enterica serovar Remo tRNA-Leu
  4857. Salmonella enterica subsp. enterica serovar Richmond tRNA-Leu
  4858. Salmonella enterica subsp. enterica serovar Rideau tRNA-Leu
  4859. Salmonella enterica subsp. enterica serovar Ridge tRNA-Leu
  4860. Salmonella enterica subsp. enterica serovar Rissen str. 150 tRNA-Leu
  4861. Salmonella enterica subsp. enterica serovar Rissen tRNA-Leu
  4862. Salmonella enterica subsp. enterica serovar Roodepoort tRNA-Leu
  4863. Salmonella enterica subsp. enterica serovar Rostock tRNA-Leu
  4864. Salmonella enterica subsp. enterica serovar Rottnest tRNA-Leu
  4865. Salmonella enterica subsp. enterica serovar Rough:b:1,2 tRNA-Leu
  4866. Salmonella enterica subsp. enterica serovar Rough O:k:1,5 tRNA-Leu
  4867. Salmonella enterica subsp. enterica serovar Rough O:-:- tRNA-Leu
  4868. Salmonella enterica subsp. enterica serovar Rough O:z29 tRNA-Leu
  4869. Salmonella enterica subsp. enterica serovar Rough O:z4,z23: tRNA-Leu
  4870. Salmonella enterica subsp. enterica serovar Rough:- tRNA-Leu
  4871. Salmonella enterica subsp. enterica serovar Rough:z10:e,n,z15 tRNA-Leu
  4872. Salmonella enterica subsp. enterica serovar Rovaniemi tRNA-Leu
  4873. Salmonella enterica subsp. enterica serovar Rubislaw str. A4-653 tRNA-Leu
  4874. Salmonella enterica subsp. enterica serovar Rubislaw str. ATCC 10717 tRNA-Leu
  4875. Salmonella enterica subsp. enterica serovar Rubislaw str. SA20030553 tRNA-Leu
  4876. Salmonella enterica subsp. enterica serovar Rubislaw tRNA-Leu
  4877. Salmonella enterica subsp. enterica serovar Ruiru tRNA-Leu
  4878. Salmonella enterica subsp. enterica serovar Saarbruecken tRNA-Leu
  4879. Salmonella enterica subsp. enterica serovar Saintpaul str. 9712 tRNA-Leu
  4880. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN000612 tRNA-Leu
  4881. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN000618 tRNA-Leu
  4882. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN000619 tRNA-Leu
  4883. Salmonella enterica subsp. enterica serovar Saintpaul str. JO2008 tRNA-Leu
  4884. Salmonella enterica subsp. enterica serovar Saintpaul str. SARA26 tRNA-Leu
  4885. Salmonella enterica subsp. enterica serovar Saintpaul tRNA-Leu
  4886. Salmonella enterica subsp. enterica serovar Salford tRNA-Leu
  4887. Salmonella enterica subsp. enterica serovar Sandiego tRNA-Leu
  4888. Salmonella enterica subsp. enterica serovar Sangera tRNA-Leu
  4889. Salmonella enterica subsp. enterica serovar Sanjuan tRNA-Leu(caa)
  4890. Salmonella enterica subsp. enterica serovar Saphra tRNA-Leu
  4891. Salmonella enterica subsp. enterica serovar Sarajane tRNA-Leu
  4892. Salmonella enterica subsp. enterica serovar Schleissheim tRNA-Leu
  4893. Salmonella enterica subsp. enterica serovar Schwarzengrund str. CVM19633 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4894. Salmonella enterica subsp. enterica serovar Schwarzengrund tRNA-Leu
  4895. Salmonella enterica subsp. enterica serovar Seattle tRNA-Leu
  4896. Salmonella enterica subsp. enterica serovar Senftenberg tRNA-Leu
  4897. Salmonella enterica subsp. enterica serovar Sekondi tRNA-Leu
  4898. Salmonella enterica subsp. enterica serovar Sendai str. CFSAN000621 tRNA-Leu
  4899. Salmonella enterica subsp. enterica serovar Sendai tRNA-Leu
  4900. Salmonella enterica subsp. enterica serovar Senegal tRNA-Leu
  4901. Salmonella enterica subsp. enterica serovar Senftenberg str. 316235162 tRNA-Leu
  4902. Salmonella enterica subsp. enterica serovar Senftenberg str. 361154004 tRNA-Leu
  4903. Salmonella enterica subsp. enterica serovar Senftenberg str. 423984-1 tRNA-Leu
  4904. Salmonella enterica subsp. enterica serovar Senftenberg str. 423984-2 tRNA-Leu
  4905. Salmonella enterica subsp. enterica serovar Senftenberg str. 604314 tRNA-Leu
  4906. Salmonella enterica subsp. enterica serovar Senftenberg str. A4-543 tRNA-Leu
  4907. Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 tRNA-Leu
  4908. Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 8400 tRNA-Leu
  4909. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004025 tRNA-Leu
  4910. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004030 tRNA-Leu
  4911. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004031 tRNA-Leu
  4912. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004032 tRNA-Leu
  4913. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004033 tRNA-Leu
  4914. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004041 tRNA-Leu
  4915. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004042 tRNA-Leu
  4916. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004043 tRNA-Leu
  4917. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004044 tRNA-Leu
  4918. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004045 tRNA-Leu
  4919. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004047 tRNA-Leu
  4920. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004048 tRNA-Leu
  4921. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004049 tRNA-Leu
  4922. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004052 tRNA-Leu
  4923. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004054 tRNA-Leu
  4924. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004055 tRNA-Leu
  4925. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004059 tRNA-Leu
  4926. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004060 tRNA-Leu
  4927. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004061 tRNA-Leu
  4928. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004062 tRNA-Leu
  4929. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004063 tRNA-Leu
  4930. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004064 tRNA-Leu
  4931. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004065 tRNA-Leu
  4932. Salmonella enterica subsp. enterica serovar Senftenberg str. NC_MB012510-0038 tRNA-Leu
  4933. Salmonella enterica subsp. enterica serovar Senftenberg str. SS209 transfer RNA-Leu
  4934. Salmonella enterica subsp. enterica serovar Senftenberg tRNA-Leu
  4935. Salmonella enterica subsp. enterica serovar Senneville tRNA-Leu
  4936. Salmonella enterica subsp. enterica serovar Shamba tRNA-Leu
  4937. Salmonella enterica subsp. enterica serovar Shubra tRNA-Leu
  4938. Salmonella enterica subsp. enterica serovar Singapore tRNA-Leu
  4939. Salmonella enterica subsp. enterica serovar Sinstorf tRNA-Leu
  4940. Salmonella enterica subsp. enterica serovar SI Rough:r:1,5 tRNA-Leu
  4941. Salmonella enterica subsp. enterica serovar Sloterdijk str. ATCC 15791 tRNA-Leu
  4942. Salmonella enterica subsp. enterica serovar Soerenga str. 695 tRNA-Leu
  4943. Salmonella enterica subsp. enterica serovar Soerenga tRNA-Leu
  4944. Salmonella enterica subsp. enterica serovar Solt tRNA-Leu
  4945. Salmonella enterica subsp. enterica serovar Somone tRNA-Leu
  4946. Salmonella enterica subsp. enterica serovar Soumbedioune tRNA-Leu
  4947. Salmonella enterica subsp. enterica serovar Southampton tRNA-Leu
  4948. Salmonella enterica subsp. enterica serovar Southbank tRNA-Leu
  4949. Salmonella enterica subsp. enterica serovar Stanley str. ATCC 7308 tRNA-Leu
  4950. Salmonella enterica subsp. enterica serovar Stanley str. CFSAN000623 tRNA-Leu
  4951. Salmonella enterica subsp. enterica serovar Stanley tRNA-Leu
  4952. Salmonella enterica subsp. enterica serovar Stanleyville str. CFSAN000624 tRNA-Leu
  4953. Salmonella enterica subsp. enterica serovar Stanleyville tRNA-Leu
  4954. Salmonella enterica subsp. enterica serovar Stockholm tRNA-Leu
  4955. Salmonella enterica subsp. enterica serovar Stourbridge tRNA-Leu
  4956. Salmonella enterica subsp. enterica serovar Stuttgart tRNA-Leu
  4957. Salmonella enterica subsp. enterica serovar Suberu tRNA-Leu
  4958. Salmonella enterica subsp. enterica serovar Suelldorf tRNA-Leu
  4959. Salmonella enterica subsp. enterica serovar Sundsvall tRNA-Leu
  4960. Salmonella enterica subsp. enterica serovar Szentes tRNA-Leu
  4961. Salmonella enterica subsp. enterica serovar Tafo tRNA-Leu
  4962. Salmonella enterica subsp. enterica serovar Takoradi tRNA-Leu
  4963. Salmonella enterica subsp. enterica serovar Taksony tRNA-Leu
  4964. Salmonella enterica subsp. enterica serovar Tallahassee str. 0012 tRNA-Leu
  4965. Salmonella enterica subsp. enterica serovar Tallahassee tRNA-Leu
  4966. Salmonella enterica subsp. enterica serovar Tamale tRNA-Leu
  4967. Salmonella enterica subsp. enterica serovar Tamberma tRNA-Leu
  4968. Salmonella enterica subsp. enterica serovar Tananarive tRNA-Leu
  4969. Salmonella enterica subsp. enterica serovar Tanger tRNA-Leu
  4970. Salmonella enterica subsp. enterica serovar Tchad tRNA-Leu
  4971. Salmonella enterica subsp. enterica serovar Teddington tRNA-Leu
  4972. Salmonella enterica subsp. enterica serovar Tees tRNA-Leu
  4973. Salmonella enterica subsp. enterica serovar Teko tRNA-Leu
  4974. Salmonella enterica subsp. enterica serovar Telaviv tRNA-Leu
  4975. Salmonella enterica subsp. enterica serovar Telelkebir tRNA-Leu
  4976. Salmonella enterica subsp. enterica serovar Telhashomer tRNA-Leu
  4977. Salmonella enterica subsp. enterica serovar Teltow tRNA-Leu
  4978. Salmonella enterica subsp. enterica serovar Tennessee str. 2691 tRNA-Leu
  4979. Salmonella enterica subsp. enterica serovar Tennessee str. 3133 tRNA-Leu
  4980. Salmonella enterica subsp. enterica serovar Tennessee str. 4535 tRNA-Leu
  4981. Salmonella enterica subsp. enterica serovar Tennessee str. PBO2007 tRNA-Leu
  4982. Salmonella enterica subsp. enterica serovar Tennessee str. TXSC_TXSC08-19 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4983. Salmonella enterica subsp. enterica serovar Tennessee str. TXSC_TXSC08-21 tRNA-Leu
  4984. Salmonella enterica subsp. enterica serovar Tennessee tRNA-Leu
  4985. Salmonella enterica subsp. enterica serovar Teshie tRNA-Leu
  4986. Salmonella enterica subsp. enterica serovar Texas tRNA-Leu
  4987. Salmonella enterica subsp. enterica serovar Thompson str. ATCC 8391 tRNA-Leu
  4988. Salmonella enterica subsp. enterica serovar Thompson str. CFSAN000625 tRNA-Leu
  4989. Salmonella enterica subsp. enterica serovar Thompson str. RM6836 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  4990. Salmonella enterica subsp. enterica serovar Thompson tRNA-Leu
  4991. Salmonella enterica subsp. enterica serovar Tilene tRNA-Leu
  4992. Salmonella enterica subsp. enterica serovar Togba tRNA-Leu
  4993. Salmonella enterica subsp. enterica serovar Toucra tRNA-Leu
  4994. Salmonella enterica subsp. enterica serovar Toulon tRNA-Leu
  4995. Salmonella enterica subsp. enterica serovar Treforest tRNA-Leu
  4996. Salmonella enterica subsp. enterica serovar Tucson tRNA-Leu
  4997. Salmonella enterica subsp. enterica serovar Tudu tRNA-Leu
  4998. Salmonella enterica subsp. enterica serovar Typhimurium str. 104772 tRNA-Leu
  4999. Salmonella enterica subsp. enterica serovar Typhimurium str. 108402 tRNA-Leu
  5000. Salmonella enterica subsp. enterica serovar Typhimurium str. 116045 tRNA-Leu
  5001. Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  5002. Salmonella enterica subsp. enterica serovar Typhimurium str. 34502 tRNA-Leu
  5003. Salmonella enterica subsp. enterica serovar Typhimurium str. 35423 tRNA-Leu
  5004. Salmonella enterica subsp. enterica serovar Typhimurium str. 36618 tRNA-Leu
  5005. Salmonella enterica subsp. enterica serovar Typhimurium str. 798 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  5006. Salmonella enterica subsp. enterica serovar Typhimurium str. 86-0368 tRNA-Leu
  5007. Salmonella enterica subsp. enterica serovar Typhimurium str. 95799 tRNA-Leu
  5008. Salmonella enterica subsp. enterica serovar Typhimurium str. 98346 tRNA-Leu
  5009. Salmonella enterica subsp. enterica serovar Typhimurium str. AZ 057 tRNA-Leu
  5010. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC_2009K1153 tRNA-Leu
  5011. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC_2009K1158 tRNA-Leu
  5012. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC_2009K1277 tRNA-Leu
  5013. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC_2009K1283 tRNA-Leu
  5014. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC_2009K1288 tRNA-Leu
  5015. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2009K-1640 tRNA-Leu
  5016. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2009K-2059 tRNA-Leu
  5017. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2010K-1587 tRNA-Leu
  5018. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2011K-0870 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  5019. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2011K-1702 tRNA-Leu
  5020. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC H2662 tRNA-Leu
  5021. Salmonella enterica subsp. enterica serovar Typhimurium str. CFSAN000643 tRNA-Leu
  5022. Salmonella enterica subsp. enterica serovar Typhimurium str. CFSAN000648 tRNA-Leu
  5023. Salmonella enterica subsp. enterica serovar Typhimurium str. CFSAN000653 tRNA-Leu
  5024. Salmonella enterica subsp. enterica serovar Typhimurium str. D23580 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  5025. Salmonella enterica subsp. enterica serovar Typhimurium str. DT104 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  5026. Salmonella enterica subsp. enterica serovar Typhimurium str. DT2 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  5027. Salmonella enterica subsp. enterica serovar Typhimurium str. L-3553 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  5028. Salmonella enterica subsp. enterica serovar Typhimurium str. LT2-4_delta.ramA::kan tRNA-Leu
  5029. Salmonella enterica subsp. enterica serovar Typhimurium str. LT2-4 tRNA-Leu
  5030. Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  5031. Salmonella enterica subsp. enterica serovar Typhimurium str. SARA13 tRNA-Leu
  5032. Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  5033. Salmonella enterica subsp. enterica serovar Typhimurium str. ST1489 tRNA-Leu
  5034. Salmonella enterica subsp. enterica serovar Typhimurium str. ST4581 tRNA-Leu
  5035. Salmonella enterica subsp. enterica serovar Typhimurium str. ST4/74 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  5036. Salmonella enterica subsp. enterica serovar Typhimurium str. STm10 tRNA-Leu
  5037. Salmonella enterica subsp. enterica serovar Typhimurium str. STm11 tRNA-Leu
  5038. Salmonella enterica subsp. enterica serovar Typhimurium str. STm12 tRNA-Leu
  5039. Salmonella enterica subsp. enterica serovar Typhimurium str. STm1 tRNA-Leu
  5040. Salmonella enterica subsp. enterica serovar Typhimurium str. STm2 tRNA-Leu
  5041. Salmonella enterica subsp. enterica serovar Typhimurium str. STm3 tRNA-Leu
  5042. Salmonella enterica subsp. enterica serovar Typhimurium str. STm4 tRNA-Leu
  5043. Salmonella enterica subsp. enterica serovar Typhimurium str. STm5 tRNA-Leu
  5044. Salmonella enterica subsp. enterica serovar Typhimurium str. STm6 tRNA-Leu
  5045. Salmonella enterica subsp. enterica serovar Typhimurium str. STm7 tRNA-Leu
  5046. Salmonella enterica subsp. enterica serovar Typhimurium str. STm8 tRNA-Leu
  5047. Salmonella enterica subsp. enterica serovar Typhimurium str. STm9 tRNA-Leu
  5048. Salmonella enterica subsp. enterica serovar Typhimurium str. T000240 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  5049. Salmonella enterica subsp. enterica serovar Typhimurium str. U288 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  5050. Salmonella enterica subsp. enterica serovar Typhimurium str. UK-1 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  5051. Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1808 tRNA-Leu
  5052. Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1810 tRNA-Leu
  5053. Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1880 tRNA-Leu
  5054. Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1896 tRNA-Leu
  5055. Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 tRNA-Leu
  5056. Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1899 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  5057. Salmonella enterica subsp. enterica serovar Typhimurium tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  5058. Salmonella enterica subsp. enterica serovar Typhimurium var. 5- str. CFSAN001921 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  5059. Salmonella enterica subsp. enterica serovar Typhimurium var. 5- str. CFSAN004345 tRNA-Leu
  5060. Salmonella enterica subsp. enterica serovar Typhimurium var. 5- tRNA-Leu
  5061. Salmonella enterica subsp. enterica serovar Typhimurium var. Copenhagen str. 0084 tRNA-Leu
  5062. Salmonella enterica subsp. enterica serovar Typhimurium var. monophasic 4,[5],12:i:- tRNA-Leu
  5063. Salmonella enterica subsp. enterica serovar Typhimurium var. monophasic 4,5,12:i:- tRNA-Leu
  5064. Salmonella enterica subsp. enterica serovar Typhi (Salmonella typhi) tRNA-Leu
  5065. Salmonella enterica subsp. enterica serovar Typhi str. 404ty tRNA-Leu
  5066. Salmonella enterica subsp. enterica serovar Typhi str. CFSAN000626 tRNA-Leu
  5067. Salmonella enterica subsp. enterica serovar Typhi str. CFSAN000628 tRNA-Leu
  5068. Salmonella enterica subsp. enterica serovar Typhi str. CT18 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  5069. Salmonella enterica subsp. enterica serovar Typhi str. STH2370 tRNA-Leu
  5070. Salmonella enterica subsp. enterica serovar Typhi str. Ty21a tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  5071. Salmonella enterica subsp. enterica serovar Typhi str. Ty2 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  5072. Salmonella enterica subsp. enterica serovar Typhisuis str. CFSAN000654 tRNA-Leu
  5073. Salmonella enterica subsp. enterica serovar Typhisuis tRNA-Leu
  5074. Salmonella enterica subsp. enterica serovar Tyresoe tRNA-Leu
  5075. Salmonella enterica subsp. enterica serovar Uganda str. R8-3404 tRNA-Leu
  5076. Salmonella enterica subsp. enterica serovar Uganda tRNA-Leu
  5077. Salmonella enterica subsp. enterica serovar Uganda var. 15+ tRNA-Leu
  5078. Salmonella enterica subsp. enterica serovar Ughelli tRNA-Leu
  5079. Salmonella enterica subsp. enterica serovar Ullevi tRNA-Leu
  5080. Salmonella enterica subsp. enterica serovar Umbilo tRNA-Leu
  5081. Salmonella enterica subsp. enterica serovar Uppsala tRNA-Leu
  5082. Salmonella enterica subsp. enterica serovar Urbana str. ATCC 9261 tRNA-Leu
  5083. Salmonella enterica subsp. enterica serovar Urbana str. R8-2977 tRNA-Leu
  5084. Salmonella enterica subsp. enterica serovar Urbana tRNA-Leu
  5085. Salmonella enterica subsp. enterica serovar Utah tRNA-Leu
  5086. Salmonella enterica subsp. enterica serovar Uzaramo tRNA-Leu
  5087. Salmonella enterica subsp. enterica serovar Vaertan tRNA-Leu
  5088. Salmonella enterica subsp. enterica serovar Vancouver tRNA-Leu
  5089. Salmonella enterica subsp. enterica serovar Vejle tRNA-Leu
  5090. Salmonella enterica subsp. enterica serovar Veneziana tRNA-Leu
  5091. Salmonella enterica subsp. enterica serovar Victoria tRNA-Leu
  5092. Salmonella enterica subsp. enterica serovar Vinohrady tRNA-Leu
  5093. Salmonella enterica subsp. enterica serovar Virchow tRNA-Leu
  5094. Salmonella enterica subsp. enterica serovar Virginia str. SA19971529 tRNA-Leu
  5095. Salmonella enterica subsp. enterica serovar Virginia tRNA-Leu
  5096. Salmonella enterica subsp. enterica serovar Vitkin tRNA-Leu
  5097. Salmonella enterica subsp. enterica serovar Volkmarsdorf tRNA-Leu
  5098. Salmonella enterica subsp. enterica serovar Vom tRNA-Leu
  5099. Salmonella enterica subsp. enterica serovar Vuadens tRNA-Leu
  5100. Salmonella enterica subsp. enterica serovar Wagenia tRNA-Leu
  5101. Salmonella enterica subsp. enterica serovar Wandsworth str. A4-580 tRNA-Leu
  5102. Salmonella enterica subsp. enterica serovar Wandsworth str. SA20092095 tRNA-Leu
  5103. Salmonella enterica subsp. enterica serovar Wandsworth tRNA-Leu
  5104. Salmonella enterica subsp. enterica serovar Wangata tRNA-Leu
  5105. Salmonella enterica subsp. enterica serovar Warnow tRNA-Leu
  5106. Salmonella enterica subsp. enterica serovar Washington tRNA-Leu
  5107. Salmonella enterica subsp. enterica serovar Wa tRNA-Leu
  5108. Salmonella enterica subsp. enterica serovar Waycross tRNA-Leu
  5109. Salmonella enterica subsp. enterica serovar Wedding tRNA-Leu
  5110. Salmonella enterica subsp. enterica serovar Welikade tRNA-Leu
  5111. Salmonella enterica subsp. enterica serovar Weltevreden str. 1655 tRNA-Leu
  5112. Salmonella enterica subsp. enterica serovar Weltevreden str. 2007-60-3289-1 tRNA-Leu
  5113. Salmonella enterica subsp. enterica serovar Weltevreden tRNA-Leu
  5114. Salmonella enterica subsp. enterica serovar Wentworth tRNA-Leu
  5115. Salmonella enterica subsp. enterica serovar Wernigerode tRNA-Leu
  5116. Salmonella enterica subsp. enterica serovar Weslaco str. 247K tRNA-Leu
  5117. Salmonella enterica subsp. enterica serovar Weslaco tRNA-Leu
  5118. Salmonella enterica subsp. enterica serovar Westhampton tRNA-Leu
  5119. Salmonella enterica subsp. enterica serovar Westminster tRNA-Leu
  5120. Salmonella enterica subsp. enterica serovar Weston tRNA-Leu
  5121. Salmonella enterica subsp. enterica serovar Weybridge tRNA-Leu
  5122. Salmonella enterica subsp. enterica serovar Widemarsh tRNA-Leu
  5123. Salmonella enterica subsp. enterica serovar Wien str. CFSAN000656 tRNA-Leu
  5124. Salmonella enterica subsp. enterica serovar Wien str. CFSAN000657 tRNA-Leu
  5125. Salmonella enterica subsp. enterica serovar Wien tRNA-Leu
  5126. Salmonella enterica subsp. enterica serovar Wilhelmsburg tRNA-Leu
  5127. Salmonella enterica subsp. enterica serovar Winterthur tRNA-Leu
  5128. Salmonella enterica subsp. enterica serovar Woodhull tRNA-Leu
  5129. Salmonella enterica subsp. enterica serovar Woodinville tRNA-Leu
  5130. Salmonella enterica subsp. enterica serovar Worthington str. ATCC 9607 tRNA-Leu
  5131. Salmonella enterica subsp. enterica serovar Worthington str. BCH-3008 tRNA-Leu
  5132. Salmonella enterica subsp. enterica serovar Worthington str. BCH-3194 tRNA-Leu
  5133. Salmonella enterica subsp. enterica serovar Worthington str. BCH-4719 tRNA-Leu
  5134. Salmonella enterica subsp. enterica serovar Worthington str. BCH-5715 tRNA-Leu
  5135. Salmonella enterica subsp. enterica serovar Worthington str. BCH-7253 tRNA-Leu
  5136. Salmonella enterica subsp. enterica serovar Worthington tRNA-Leu
  5137. Salmonella enterica subsp. enterica serovar Wyldegreen tRNA-Leu
  5138. Salmonella enterica subsp. enterica serovar Yolo tRNA-Leu
  5139. Salmonella enterica subsp. enterica serovar Yoruba tRNA-Leu
  5140. Salmonella enterica subsp. enterica serovar Yovokome str. S-1850 tRNA-Leu
  5141. Salmonella enterica subsp. enterica serovar Yovokome tRNA-Leu
  5142. Salmonella enterica subsp. enterica serovar Zaiman tRNA-Leu
  5143. Salmonella enterica subsp. enterica serovar Zanzibar tRNA-Leu
  5144. Salmonella enterica subsp. enterica serovar Zega tRNA-Leu
  5145. Salmonella enterica subsp. enterica tRNA-Leu
  5146. Salmonella enterica subsp. houtenae serovar 1,40:z4,z32:- tRNA-Leu
  5147. Salmonella enterica subsp. houtenae serovar 21:z4,z23:- tRNA-Leu
  5148. Salmonella enterica subsp. houtenae serovar 40:z4,z24:- tRNA-Leu
  5149. Salmonella enterica subsp. houtenae serovar 40:z4,z32:- tRNA-Leu
  5150. Salmonella enterica subsp. houtenae serovar 41:z4,z23:- tRNA-Leu
  5151. Salmonella enterica subsp. houtenae serovar 43:z4 tRNA-Leu
  5152. Salmonella enterica subsp. houtenae serovar 43:z4,z32:- tRNA-Leu
  5153. Salmonella enterica subsp. houtenae serovar 44:z36,[z38]:- tRNA-Leu
  5154. Salmonella enterica subsp. houtenae serovar 44:z36[z38]:- tRNA-Leu
  5155. Salmonella enterica subsp. houtenae serovar 44:z4,z23:- tRNA-Leu
  5156. Salmonella enterica subsp. houtenae serovar 45:g,z51:- tRNA-Leu
  5157. Salmonella enterica subsp. houtenae serovar 48:g,z51:- tRNA-Leu
  5158. Salmonella enterica subsp. houtenae serovar Houten tRNA-Leu
  5159. Salmonella enterica subsp. houtenae str. ATCC BAA-1581 tRNA-Leu
  5160. Salmonella enterica subsp. houtenae tRNA-Leu
  5161. Salmonella enterica subsp. indica serovar 41:b:1,7 tRNA-Leu
  5162. Salmonella enterica subsp. indica serovar 45:a:e,n,x tRNA-Leu
  5163. Salmonella enterica subsp. indica serovar 6,14,25:z10:1,(2),7 str. 1121 tRNA-Leu
  5164. Salmonella enterica subsp. indica serovar Marseille tRNA-Leu
  5165. Salmonella enterica subsp. indica tRNA-Leu
  5166. Salmonella enterica subsp. salamae serovar 13,22:z:- tRNA-Leu
  5167. Salmonella enterica subsp. salamae serovar 16:m,t:- tRNA-Leu
  5168. Salmonella enterica subsp. salamae serovar 18:z10:z6 tRNA-Leu
  5169. Salmonella enterica subsp. salamae serovar 30:1,z28:z6 tRNA-Leu
  5170. Salmonella enterica subsp. salamae serovar 42:b:1,5 tRNA-Leu
  5171. Salmonella enterica subsp. salamae serovar 42:f,g,t:-- tRNA-Leu
  5172. Salmonella enterica subsp. salamae serovar 42:r:- tRNA-Leu
  5173. Salmonella enterica subsp. salamae serovar 42:z:1,5 tRNA-Leu
  5174. Salmonella enterica subsp. salamae serovar 47:a:1,5 tRNA-Leu
  5175. Salmonella enterica subsp. salamae serovar 47:b:1,5 tRNA-Leu
  5176. Salmonella enterica subsp. salamae serovar 48:d:z6 tRNA-Leu
  5177. Salmonella enterica subsp. salamae serovar 55:k:z39 str. 1315K tRNA-Leu
  5178. Salmonella enterica subsp. salamae serovar 56:b:[1,5] tRNA-Leu
  5179. Salmonella enterica subsp. salamae serovar 56:z10:e,n,x str. 1369-73 tRNA-Leu
  5180. Salmonella enterica subsp. salamae serovar 56:z10:e,n,x tRNA-Leu
  5181. Salmonella enterica subsp. salamae serovar 57:z29:z42 tRNA-Leu
  5182. Salmonella enterica subsp. salamae serovar 58:a:- tRNA-Leu
  5183. Salmonella enterica subsp. salamae serovar 58:d:z6 tRNA-Leu
  5184. Salmonella enterica subsp. salamae serovar 58:l,z13,z28:z6 str. 00-0163 tRNA-Leu
  5185. Salmonella enterica subsp. salamae serovar 58:l,z13,z28:z6 tRNA-Leu
  5186. Salmonella enterica subsp. salamae serovar 60:g,m,t:z6 tRNA-Leu
  5187. Salmonella enterica subsp. salamae serovar Greenside tRNA-Leu
  5188. Salmonella enterica subsp. salamae serovar Sofia tRNA-Leu
  5189. Salmonella enterica subsp. salamae serovar Springs tRNA-Leu
  5190. Salmonella enterica subsp. salamae str. CFSAN000559 tRNA-Leu
  5191. Salmonella enterica subsp. salamae tRNA-Leu
  5192. Salmonella enterica subsp. VII serovar 1,40:g,z51:-- tRNA-Leu
  5193. Salmonella enterica subsp. VII serovar 40:z4,z24:[z39] tRNA-Leu
  5194. Salmonella enterica subsp. VII str. CFSAN000554 tRNA-Leu
  5195. Salmonella enterica tRNA-Leu
  5196. Salmonella sp. 2018103 tRNA-Leu
  5197. Salmonella sp. 32010201201800099SM tRNA-Leu
  5198. Salmonella sp. 32010601-2015-00010-FB-01-SM-01 tRNA-Leu
  5199. Salmonella sp. 32010601-2015-00137-FB-01-SM-01 tRNA-Leu
  5200. Salmonella sp. 32010601201600049SM tRNA-Leu
  5201. Salmonella sp. 32010601201600067SM tRNA-Leu
  5202. Salmonella sp. 32010601201800023SM tRNA-Leu
  5203. Salmonella sp. 32010601201800030SM tRNA-Leu
  5204. Salmonella sp. 32011103201800031SM tRNA-Leu
  5205. Salmonella sp. 32011103201800106SM tRNA-Leu
  5206. Salmonella sp. 32011401201800036SM tRNA-Leu
  5207. Salmonella sp. 32011401-201800074SM tRNA-Leu
  5208. Salmonella sp. 32011501201800079SM tRNA-Leu
  5209. Salmonella sp. 32011602201600097SM tRNA-Leu
  5210. Salmonella sp. 32011602201600105SM tRNA-Leu
  5211. Salmonella sp. 32011602201800010SM tRNA-Leu
  5212. Salmonella sp. 32011602201800014SM tRNA-Leu
  5213. Salmonella sp. 32011801201800027SM tRNA-Leu
  5214. Salmonella sp. 32020114201800008SM tRNA-Leu
  5215. Salmonella sp. 32020201-2017-00050-FB-01-SM-01 tRNA-Leu
  5216. Salmonella sp. 32020210201800012SM tRNA-Leu
  5217. Salmonella sp. 32020301-2015-00098-FB-01-SM-01 tRNA-Leu
  5218. Salmonella sp. 32020501-2015-00069-FB-01-SM-01 tRNA-Leu
  5219. Salmonella sp. 32020501-2019-00039 tRNA-Leu
  5220. Salmonella sp. 32020501-2019-00040 tRNA-Leu
  5221. Salmonella sp. 32020501-2019-00041 tRNA-Leu
  5222. Salmonella sp. 32020501-2019-00044 tRNA-Leu
  5223. Salmonella sp. 32020501-2019-00050 tRNA-Leu
  5224. Salmonella sp. 32020501-2019-00052 tRNA-Leu
  5225. Salmonella sp. 32020509201800054SM tRNA-Leu
  5226. Salmonella sp. 32020509201800068SM tRNA-Leu
  5227. Salmonella sp. 32020512-2019-00017 tRNA-Leu
  5228. Salmonella sp. 32020614-2019-00048 tRNA-Leu
  5229. Salmonella sp. 32021105201800037SM tRNA-Leu
  5230. Salmonella sp. 32031101201600128SM tRNA-Leu
  5231. Salmonella sp. 3203110320150095SM tRNA-Leu
  5232. Salmonella sp. 3203110320150106SM tRNA-Leu
  5233. Salmonella sp. 32031103201600220SM tRNA-Leu
  5234. Salmonella sp. 32031103201600241SM tRNA-Leu
  5235. Salmonella sp. 32031103201600284SM tRNA-Leu
  5236. Salmonella sp. 32031103201600383SM tRNA-Leu
  5237. Salmonella sp. 3203110320160044 tRNA-Leu
  5238. Salmonella sp. 3203110320160052 tRNA-Leu
  5239. Salmonella sp. 3203110320160127 tRNA-Leu
  5240. Salmonella sp. 3203110320160165 tRNA-Leu
  5241. Salmonella sp. 3203110320160211 tRNA-Leu
  5242. Salmonella sp. 32031103-2018-00083-FB-01-SM-01 tRNA-Leu
  5243. Salmonella sp. 32031103-2018-0023-FB-01-SM-01 tRNA-Leu
  5244. Salmonella sp. 32040202-2015-00022-FB-01-SM-01 tRNA-Leu
  5245. Salmonella sp. 32040203201700040FB01SM01 tRNA-Leu
  5246. Salmonella sp. 32040203201700113FB01SM01 tRNA-Leu
  5247. Salmonella sp. 32040203-2019-00004 tRNA-Leu
  5248. Salmonella sp. 32040203-2019-00032 tRNA-Leu
  5249. Salmonella sp. 32040203-2019-00058 tRNA-Leu
  5250. Salmonella sp. 32040203-2019-00061 tRNA-Leu
  5251. Salmonella sp. 32040203-2019-00097 tRNA-Leu
  5252. Salmonella sp. 32040203-2019-00118 tRNA-Leu
  5253. Salmonella sp. 32040203-2019-00127 tRNA-Leu
  5254. Salmonella sp. 32040203-2019-00133 tRNA-Leu
  5255. Salmonella sp. 32040203-2019-00159 tRNA-Leu
  5256. Salmonella sp. 32040203-2019-00173 tRNA-Leu
  5257. Salmonella sp. 32040209201700048FB01SM01 tRNA-Leu
  5258. Salmonella sp. 32048101-2015-00023-GS-01-SM-01 tRNA-Leu
  5259. Salmonella sp. 32048101-2015-00025-GS-01-SM-01 tRNA-Leu
  5260. Salmonella sp. 32058101201500184GS-01-SM-01 tRNA-Leu
  5261. Salmonella sp. 32070006-2019-00075 tRNA-Leu
  5262. Salmonella sp. 32070301201500052SM tRNA-Leu
  5263. Salmonella sp. 32070601201500089SM tRNA-Leu
  5264. Salmonella sp. 32070601201800144SM tRNA-Leu
  5265. Salmonella sp. 32080201-2017-00039-FB-01-SM-01 tRNA-Leu
  5266. Salmonella sp. 32081101-2017-00024-FB-01-SM-01 tRNA-Leu
  5267. Salmonella sp. 32082101-2017-00322-FB-01-SM-01 tRNA-Leu
  5268. Salmonella sp. 32082101-2019-00528 tRNA-Leu
  5269. Salmonella sp. 32090202-2015-00079-FB-01-SM-01 tRNA-Leu
  5270. Salmonella sp. 32100201201700021SM tRNA-Leu
  5271. Salmonella sp. 32100201201700044SM tRNA-Leu
  5272. Salmonella sp. 32100201201700098SM tRNA-Leu
  5273. Salmonella sp. 32100201201700099SM tRNA-Leu
  5274. Salmonella sp. 32100201201700133SM tRNA-Leu
  5275. Salmonella sp. 32100202201700047SM tRNA-Leu
  5276. Salmonella sp. 32100202201700100SM tRNA-Leu
  5277. Salmonella sp. 32101201-2018-00131-FB-01-SM-01 tRNA-Leu
  5278. Salmonella sp. 32118201201500025SM tRNA-Leu
  5279. Salmonella sp. 32120201201500036SM tRNA-Leu
  5280. Salmonella sp. 32120201201600049SM tRNA-Leu
  5281. Salmonella sp. 32120201201600070SM tRNA-Leu
  5282. Salmonella sp. 32120201201700095FB-01-SM-01 tRNA-Leu
  5283. Salmonella sp. 32120201201700135FB-01-SM-01 tRNA-Leu
  5284. Salmonella sp. 32120201201700237FB-01-SM-01 tRNA-Leu
  5285. Salmonella sp. 32120202201500105SM tRNA-Leu
  5286. Salmonella sp. 32120202201500174SM tRNA-Leu
  5287. Salmonella sp. 32120202201600072SM tRNA-Leu
  5288. Salmonella sp. 32120202201600097SM tRNA-Leu
  5289. Salmonella sp. 32120202201600158SM tRNA-Leu
  5290. Salmonella sp. 32120203201500024SM tRNA-Leu
  5291. Salmonella sp. 32120203201700065FB-01-SM-01 tRNA-Leu
  5292. Salmonella sp. 32130201201500050SM tRNA-Leu
  5293. Salmonella sp. 32130201-2017-00038SM tRNA-Leu
  5294. Salmonella sp. 32132402-2017-00107SM tRNA-Leu
  5295. Salmonella sp. 3C tRNA-Leu
  5296. Salmonella sp. 3DZ2-4SM tRNA-Leu
  5297. Salmonella sp. CVCC 1806 tRNA-Leu
  5298. Salmonella sp. D5-9891 tRNA-Leu
  5299. Salmonella sp. gx-f7 tRNA-Leu
  5300. Salmonella sp. gx-f9 tRNA-Leu
  5301. Salmonella sp. HMSC13B08 tRNA-Leu
  5302. Salmonella sp. hn-f5 tRNA-Leu
  5303. Salmonella sp. hn-h2 tRNA-Leu
  5304. Salmonella sp. hn-h4 tRNA-Leu
  5305. Salmonella sp. HNK130 tRNA-Leu
  5306. Salmonella sp. JS051105201500009SM tRNA-Leu
  5307. Salmonella sp. S13 tRNA-Leu
  5308. Salmonella sp. SAL-007 tRNA-Leu
  5309. Salmonella sp. SAL-020 tRNA-Leu
  5310. Salmonella sp. SAL-045 tRNA-Leu
  5311. Salmonella sp. SCFS4 tRNA-Leu
  5312. Salmonella sp. sc-h42 tRNA-Leu
  5313. Salmonella sp. sc-h43 tRNA-Leu
  5314. Salmonella sp. SJTUF14076 tRNA-Leu
  5315. Salmonella sp. SJTUF14146 tRNA-Leu
  5316. Salmonella sp. SJTUF14152 tRNA-Leu
  5317. Salmonella sp. SJTUF14154 tRNA-Leu
  5318. Salmonella sp. SJTUF14170 tRNA-Leu
  5319. Salmonella sp. SJTUF14178 tRNA-Leu
  5320. Salmonella sp. SJTUF14523 tRNA-Leu
  5321. Salmonella sp. SJTUF15034 tRNA-Leu
  5322. Salmonella sp. SSDFZ54 tRNA-Leu
  5323. Salmonella sp. SSDFZ69 tRNA-Leu
  5324. Salmonella sp. WGH-01 tRNA-Leu
  5325. Salmonella sp. XN2 tRNA-Leu
  5326. Salmonella sp. zj-f100 tRNA-Leu
  5327. Salmonella sp. zj-f50 tRNA-Leu
  5328. Salmonella sp. zj-f54 tRNA-Leu
  5329. Salmonella sp. zj-f60 tRNA-Leu
  5330. Salmonella sp. zj-f75 tRNA-Leu
  5331. Salmonella sp. zj-f78 tRNA-Leu
  5332. Salmonella sp. zj-f95 tRNA-Leu
  5333. Serratia fonticola tRNA-Leu
  5334. Serratia liquefaciens tRNA-Leu(caa)
  5335. Serratia marcescens tRNA-Leu
  5336. Serratia nematodiphila tRNA-Leu
  5337. Serratia sp. Ag1 tRNA-Leu
  5338. Serratia sp. Ag2 tRNA-Leu
  5339. Serratia symbiotica tRNA-Leu
  5340. Serratia symbiotica SCt-VLC transfer RNA Leucine
  5341. Serratia ureilytica tRNA-Leu
  5342. Shigella boydii 3594-74 tRNA-Leu
  5343. Shigella boydii 4444-74 tRNA-Leu
  5344. Shigella boydii 5216-82 tRNA-Leu
  5345. Shigella boydii 965-58 tRNA-Leu
  5346. Shigella boydii CDC 3083-94 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  5347. Shigella boydii Sb227 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  5348. Shigella boydii tRNA-Leu(caa)
  5349. Shigella dysenteriae 155-74 tRNA-Leu
  5350. Shigella dysenteriae 1617 tRNA-Leu
  5351. Shigella dysenteriae 225-75 tRNA-Leu
  5352. Shigella dysenteriae Sd197 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  5353. Shigella dysenteriae tRNA-Leu(caa)
  5354. Shigella dysenteriae WRSd3 tRNA-Leu
  5355. Shigella flexneri 1235-66 tRNA-Leu
  5356. Shigella flexneri 1485-80 tRNA-Leu
  5357. Shigella flexneri 1a tRNA-Leu
  5358. Shigella flexneri 1b tRNA-Leu
  5359. Shigella flexneri 1c tRNA-Leu
  5360. Shigella flexneri 2002017 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  5361. Shigella flexneri 2003036 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  5362. Shigella flexneri 2747-71 tRNA-Leu
  5363. Shigella flexneri 2850-71 tRNA-Leu
  5364. Shigella flexneri 2930-71 tRNA-Leu
  5365. Shigella flexneri 2a str. 2457T tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  5366. Shigella flexneri 2a str. 301 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  5367. Shigella flexneri 2a tRNA-Leu(caa)
  5368. Shigella flexneri 2b tRNA-Leu(caa)
  5369. Shigella flexneri 3a tRNA-Leu
  5370. Shigella flexneri 3b tRNA-Leu
  5371. Shigella flexneri 4343-70 tRNA-Leu
  5372. Shigella flexneri 4c tRNA-Leu
  5373. Shigella flexneri 5a str. M90T tRNA-Leu
  5374. Shigella flexneri 5 str. 8401 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  5375. Shigella flexneri 6603-63 tRNA-Leu
  5376. Shigella flexneri CCH060 tRNA-Leu
  5377. Shigella flexneri G1663 tRNA-Leu
  5378. Shigella flexneri K-1770 tRNA-Leu
  5379. Shigella flexneri K-218 tRNA-Leu
  5380. Shigella flexneri K-227 tRNA-Leu
  5381. Shigella flexneri K-272 tRNA-Leu
  5382. Shigella flexneri K-304 tRNA-Leu
  5383. Shigella flexneri K-315 tRNA-Leu
  5384. Shigella flexneri K-404 tRNA-Leu
  5385. Shigella flexneri K-671 tRNA-Leu
  5386. Shigella flexneri SFJ17B tRNA-Leu
  5387. Shigella flexneri Shi06HN006 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  5388. Shigella flexneri tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  5389. Shigella flexneri VA-6 tRNA-Leu
  5390. Shigella flexneri Y tRNA-Leu
  5391. Shigella sonnei 3226-85 tRNA-Leu
  5392. Shigella sonnei 3233-85 tRNA-Leu
  5393. Shigella sonnei 4822-66 tRNA-Leu
  5394. Shigella sonnei 53G tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  5395. Shigella sonnei Ss046 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  5396. Shigella sonnei str. Moseley tRNA-Leu
  5397. Shigella sonnei tRNA-Leu(caa)
  5398. Shigella sp. CLA-AA-H239 tRNA-Leu
  5399. Shigella sp. (Escherichia coli 20-139 metagenome) tRNA-Leu
  5400. Shigella sp. FC1056 tRNA-Leu
  5401. Shigella sp. FC1139 tRNA-Leu
  5402. Shigella sp. FC1172 tRNA-Leu
  5403. Shigella sp. FC1180 tRNA-Leu
  5404. Shigella sp. FC1544 tRNA-Leu
  5405. Shigella sp. FC1661 tRNA-Leu
  5406. Shigella sp. FC1708 tRNA-Leu
  5407. Shigella sp. FC1737 tRNA-Leu
  5408. Shigella sp. FC1764 tRNA-Leu
  5409. Shigella sp. FC1882 tRNA-Leu
  5410. Shigella sp. FC2045 tRNA-Leu
  5411. Shigella sp. FC2125 tRNA-Leu
  5412. Shigella sp. FC2175 tRNA-Leu
  5413. Shigella sp. FC2383 tRNA-Leu
  5414. Shigella sp. FC2531 tRNA-Leu
  5415. Shigella sp. FC2541 tRNA-Leu
  5416. Shigella sp. FC2710 tRNA-Leu
  5417. Shigella sp. FC2833 tRNA-Leu
  5418. Shigella sp. FC2928 tRNA-Leu
  5419. Shigella sp. FC3196 tRNA-Leu
  5420. Shigella sp. PAMC 28760 tRNA-Leu
  5421. Shigella sp. PIB tRNA-Leu
  5422. Shimwellia blattae DSM 4481 = NBRC 105725 tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  5423. Shimwellia blattae tRNA-Leu(caa)
  5424. Siccibacter colletis tRNA-Leu
  5425. Siccibacter turicensis tRNA-Leu
  5426. Staphylococcus epidermidis tRNA-Leu
  5427. Staphylococcus lugdunensis tRNA-Leu
  5428. Streptococcus pneumoniae tRNA-Leu(caa)
  5429. synthetic Escherichia coli C321.deltaA tRNA-Leu (CAA) (tRNA-Leu-CAA-1-1)
  5430. Tatumella citrea tRNA-Leu
  5431. Tatumella morbirosei tRNA-Leu
  5432. Tatumella sp. JGM100 tRNA-Leu
  5433. Tatumella sp. JGM130 tRNA-Leu
  5434. Tatumella sp. JGM16 tRNA-Leu
  5435. Tatumella sp. JGM82 tRNA-Leu
  5436. Tatumella sp. JGM91 tRNA-Leu
  5437. Tatumella sp. JGM94 tRNA-Leu
  5438. Tenebrionibacter intestinalis tRNA-Leu
  5439. Tenebrionicola larvae tRNA-Leu
  5440. Veillonella sp. tRNA-Leu
  5441. Vibrio parahaemolyticus tRNA-Leu
  5442. Vibrio sp. FNV 38 tRNA-Leu
  5443. Yokenella regensburgei tRNA-Leu
2D structure Publications