Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-505-5p URS000017EA6A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-505: Hsa-mir-505 is a downregulated microRNA that has been found to be lower in the low-risk group compared to the high-risk group in a study using a heatmap of the 6-miRNA profile [PMC6661144]. In another study using the GSE51674 dataset, hsa-mir-505 was identified as one of the differentially expressed miRNAs in kidney tissues of diabetic nephropathy (DN) patients compared to healthy individuals [PMC8616647]. Hsa-mir-505 has also been reported to suppress cell proliferation and invasion in endometrial carcinoma and gastric cancer by targeting specific mRNAs [PMC6661144]. In miRNA sequencing data, hsa-mir-505 was identified as one of the downregulated miRNAs in HCC, along with other miRNAs such as hsa-miR-424 and hsa-miR-16-1 [PMC7401655]. Additionally, hsa-mir-505 was selected for further analysis in HCC due to its fold change >5 [PMC3565310]. In summary, hsa-mir-505 is a downregulated microRNA that has been implicated in various diseases such as DN and HCC. It has been shown to have potential roles in cell proliferation and invasion. Further research is needed to fully understand its functions and potential therapeutic applications.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGAGCCAGGAAGUAUUGAUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

Publications