v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Taeniopygia guttata (zebra finch) Tgu-Mir-101-P1-v2_5p* (star (passenger)) URS000017D10B_59729

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CAGUUAUCACAGUGCUGAUGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 27 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-101-P1-v2_5p* (star (passenger))
  2. Bos taurus (domestic cattle) Bta-Mir-101-P1-v2_5p* (star (passenger))
  3. Callithrix jacchus (white-tufted-ear marmoset) Cja-Mir-101-P1-v2_5p* (star (passenger))
  4. Canis lupus familiaris Cfa-Mir-101-P1-v2_5p* (star (passenger))
  5. Cavia porcellus Cpo-Mir-101-P1-v2_5p* (star (passenger))
  6. Chrysemys picta bellii (western painted turtle) Cpi-Mir-101-P1-v2_5p* (star (passenger))
  7. Columba livia Cli-Mir-101-P1-v2_5p* (star (passenger))
  8. Danio rerio (zebrafish) Dre-Mir-101-P1-v2_5p* (star (passenger))
  9. Dasypus novemcinctus Dno-Mir-101-P1-v2_5p* (star (passenger))
  10. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-101-P1-v2_5p* (star (passenger))
  11. Equus caballus (horse) Eca-Mir-101-P1-v2_5p* (star (passenger))
  12. Gallus gallus Gga-Mir-101-P1-v2_5p* (star (passenger))
  13. Homo sapiens (human) hsa-miR-101-5p
  14. Lepisosteus oculatus (spotted gar) Loc-Mir-101-P1-v2_5p* (star (passenger))
  15. Loxodonta africana (African savanna elephant) Laf-Mir-101-P1-v2_5p* (star (passenger))
  16. Macaca mulatta Mml-Mir-101-P1-v2_5p* (star (passenger))
  17. Microcaecilia unicolor Mun-Mir-101-P1-v2_5p* (star (passenger))
  18. Monodelphis domestica Mdo-Mir-101-P1-v2_5p* (star (passenger))
  19. Mus musculus (house mouse) Mmu-Mir-101-P1-v2_5p* (star (passenger))
  20. Ornithorhynchus anatinus Oan-Mir-101-P1-v2_5p* (star (passenger))
  21. Oryctolagus cuniculus Ocu-Mir-101-P1-v2_5p* (star (passenger))
  22. Pongo abelii (Sumatran orangutan) Pab-Mir-101-P1-v2_5p* (star (passenger))
  23. Rattus norvegicus Rno-Mir-101-P1-v2_5p* (star (passenger))
  24. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-101-P1-v2_5p* (star (passenger))
  25. Scyliorhinus torazame (cloudy catshark) Sto-Mir-101-P1-v2_5p* (star (passenger))
  26. Xenopus laevis (African clawed frog) Xla-Mir-101-P1b-v2_5p* (star (passenger))
  27. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-101-P1-v2_5p* (star (passenger))
 Relationships

Molecular Relationships