v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Amycolatopsis orientalis HCCB10007 5S ribosomal RNA secondary structure diagram

Amycolatopsis orientalis HCCB10007 5S ribosomal RNA URS000017C996_1156913

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUUUCGGUGGUUAUAGCGUCAGGGAAACGCCCGGUCCCAUUCCGAACCCGGAAGCUAAGCCUGACAGCGCCGAUGGUACUGCAACCGAAGGGUUGUGGGAGAGUAGGACACCGCCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Amycolatopsis keratiniphila 5S ribosomal RNA
  2. Amycolatopsis orientalis 5S rRNA
  3. Amycolatopsis sp. MJM2582 5S rRNA
 2D structure