Capra hircus (goat) microRNA chi-mir-665 precursor

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Capra hircus (goat) microRNA chi-mir-665 precursor URS000017C018_9925

96 nucleotides
2 databases (miRBase, RefSeq)
Found in 6 other species
20 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

CCUGGAGGAGGGUCUCCUUGAGGGGUCUUGGCCUCUGCCCAGGACUCUUUCAUGACCAGUAGGCCGAGGCCCCUCACAGGCGGCUGCUUACUCUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

Bison bison bison microRNA 665 (ENSBBBG00000023415.1)
Bos indicus x Bos taurus (hybrid cattle) miRNA (ENSBIXG00000014030.1, ENSBIXG00005015810.1)
Bos mutus (wild yak) microRNA 665 (ENSBMUG00000004846.1)
Bos taurus microRNA 665 (ENSBTAG00000037265.3)
Moschus moschiferus microRNA 665 (ENSMMSG00000004927.1)
Ovis aries (sheep) microRNA mir-665 (ENSOARG00020018556.2)

2D structure

Publications