Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-499-5p URS000017B171_7955

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUAAGACUUGCAGUGAUGUUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 38 other species

  1. Alligator mississippiensis Ami-Mir-499_5p (mature (guide))
  2. Anolis carolinensis aca-miR-499-5p
  3. Bos taurus (cattle) Bta-Mir-499_5p (mature (guide))
  4. Canis lupus familiaris (dog) Cfa-Mir-499_5p (mature (guide))
  5. Cavia porcellus cpo-miR-499-5p
  6. Cervus elaphus (red deer) cel-miR-499
  7. Chrysemys picta bellii (western painted turtle) Cpi-Mir-499_5p (mature (guide))
  8. Chrysemys picta cpi-miR-499-5p
  9. Cricetulus griseus (Chinese hamster) cgr-miR-499-5p
  10. Cyprinus carpio ccr-miR-499
  11. Dasypus novemcinctus dno-miR-499-5p
  12. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-499_5p (mature (guide))
  13. Gadus morhua gmo-miR-499-5p
  14. Gekko japonicus Gja-Mir-499_5p (mature (guide))
  15. Haplochromis burtoni abu-miR-499
  16. Homo sapiens (human) Hsa-Mir-499_5p (mature (guide))
  17. Latimeria chalumnae Lch-Mir-499_5p (mature (guide))
  18. Lepisosteus oculatus (spotted gar) Loc-Mir-499_5p (mature (guide))
  19. Macaca mulatta (Rhesus monkey) Mml-Mir-499_5p (mature (guide))
  20. Maylandia zebra (zebra mbuna) mze-miR-499
  21. Microcaecilia unicolor Mun-Mir-499_5p (mature (guide))
  22. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-499_5p (mature (guide))
  23. Monopterus albus (swamp eel) Mal-Mir-499-P1_5p (mature (guide))
  24. Mus musculus (house mouse) Mmu-Mir-499_5p (mature (guide))
  25. Neolamprologus brichardi nbr-miR-499
  26. Oreochromis niloticus oni-miR-499
  27. Oryctolagus cuniculus (rabbit) ocu-miR-499-5p
  28. Pundamilia nyererei pny-miR-499
  29. Python bivittatus pbv-miR-499-5p
  30. Rattus norvegicus (Norway rat) Rno-Mir-499_5p (mature (guide))
  31. Salmo salar (Atlantic salmon) ssa-miR-499b-5p
  32. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-499_5p (mature (guide))
  33. Scyliorhinus torazame (cloudy catshark) Sto-Mir-499_5p (mature (guide))
  34. Sphenodon punctatus (tuatara) Spt-Mir-499_5p (mature (guide))
  35. Tetraodon nigroviridis Tni-Mir-499-P1_5p (mature (guide))
  36. Tor tambroides (Thai mahseer) miR-499-5p
  37. Xenopus laevis (African clawed frog) xla-miR-499-5p
  38. Xenopus tropicalis Xtr-Mir-499_5p (mature (guide))
Publications