Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila elegans (Pomace flies) tRNA-Gln secondary structure diagram

Drosophila elegans (Pomace flies) tRNA-Gln URS000017A2F3_30023

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUUCCAUGGUGUAAUGGUUAGCACUCAGGACUCUGAAUCCUGCGAUCCGAGUUCAAAUCUCGGUGGAACCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 87 other species

  1. Anastrepha ludens (Mexican fruit fly) transfer RNA glutamine (anticodon CUG)
  2. Anastrepha obliqua (WestIndian fruit fly) transfer RNA glutamine (anticodon CUG)
  3. Anopheles arabiensis tRNA tRNA-Gln
  4. Anopheles coluzzii (Mosquito) tRNA-Gln for anticodon CUG
  5. Anopheles gambiae tRNA tRNA-Gln
  6. Anopheles gambiae str. PEST tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  7. Anopheles maculatus (Mosquito) tRNA tRNA-Gln
  8. Anopheles melas tRNA tRNA-Gln
  9. Anopheles merus (Mosquito) tRNA tRNA-Gln
  10. Anopheles quadriannulatus (Mosquito) tRNA tRNA-Gln
  11. Anopheles stephensi (Asian malaria mosquito) tRNA tRNA-Gln
  12. Bactrocera dorsalis (Oriental fruit fly) transfer RNA glutamine (anticodon CUG)
  13. Bactrocera latifrons (Solanum fruit fly) tRNA-Gln
  14. Bactrocera neohumeralis (Lesser Queensland fruit fly) transfer RNA glutamine (anticodon CUG)
  15. Bactrocera oleae (Olive fruit fly) tRNA-Gln
  16. Bactrocera tryoni tRNA-Gln
  17. Boreogadus saida tRNA-Gln
  18. Branchiostoma floridae tRNA-Gln (CTG) (tRNA-Gln-CTG-2-1)
  19. Candidula unifasciata tRNA
  20. Ceratitis capitata tRNA-Gln
  21. Coremacera marginata (Sieve-winged Snailkiller) misc RNA ENSCNRG00005015302.1
  22. Culex pipiens pallens (Northern house mosquito) transfer RNA glutamine (anticodon CUG)
  23. Culex quinquefasciatus tRNA
  24. Dissostichus eleginoides tRNA-Gln
  25. Dissostichus mawsoni tRNA
  26. Ditylenchus dipsaci tRNA
  27. Drosophila albomicans (Fruit fly) transfer RNA glutamine (anticodon CUG)
  28. Drosophila ananassae tRNA-Gln (CTG) (tRNA-Gln-CTG-3 1 to 6)
  29. Drosophila arizonae (Fruit fly) tRNA-Gln
  30. Drosophila biarmipes (Fruit fly) transfer RNA glutamine (anticodon CUG)
  31. Drosophila bipectinata (Pomace flies) transfer RNA glutamine (anticodon CUG)
  32. Drosophila busckii (Fruit fly) tRNA-Gln
  33. Drosophila erecta tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 5)
  34. Drosophila eugracilis (Fruit fly) tRNA-Gln
  35. Drosophila ficusphila (Fruit fly) tRNA-Gln
  36. Drosophila grimshawi tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 10)
  37. Drosophila guanche (Fruit fly) tRNA-Gln
  38. Drosophila gunungcola (Fruit fly) transfer RNA glutamine (anticodon CUG)
  39. Drosophila hydei (Fruit fly) tRNA-Gln
  40. Drosophila innubila (Fruit fly) tRNA-Gln
  41. Drosophila kikkawai (Pomace flies) transfer RNA glutamine (anticodon CUG)
  42. Drosophila mauritiana (Fruit fly) tRNA-Gln
  43. Drosophila melanogaster transfer RNA:Glutamine-CTG 2-5 (Dmel_CR31669, Dmel_CR31939, Dmel_CR31943, Dmel_CR31944, Dmel_CR32785)
  44. Drosophila miranda (Fruit fly) tRNA-Gln
  45. Drosophila mojavensis tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 5)
  46. Drosophila montana (Pomace flies) transfer RNA glutamine (anticodon CUG)
  47. Drosophila nasuta (Pomace flies) transfer RNA glutamine (anticodon CUG)
  48. Drosophila navojoa (Fruit fly) tRNA-Gln
  49. Drosophila novamexicana (Pomace flies) tRNA-Gln
  50. Drosophila obscura (Fruit fly) tRNA-Gln
  51. Drosophila persimilis tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  52. Drosophila pseudoobscura (Fruit fly) tRNA-Gln
  53. Drosophila pseudoobscura pseudoobscura tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  54. Drosophila rhopaloa (Fruit fly) tRNA-Gln
  55. Drosophila santomea (Fruit fly) tRNA-Gln
  56. Drosophila sechellia tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 5)
  57. Drosophila serrata (Pomace flies) tRNA-Gln
  58. Drosophila simulans tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 5)
  59. Drosophila subobscura (Fruit fly) tRNA-Gln
  60. Drosophila subpulchrella (Fruit fly) tRNA-Gln
  61. Drosophila sulfurigaster albostrigata (Flies) transfer RNA glutamine (anticodon CUG)
  62. Drosophila suzukii (Pomace flies) transfer RNA glutamine (anticodon CUG)
  63. Drosophila takahashii (Pomace flies) transfer RNA glutamine (anticodon CUG)
  64. Drosophila teissieri (Fruit fly) tRNA-Gln
  65. Drosophila tropicalis (Pomace flies) transfer RNA glutamine (anticodon CUG)
  66. Drosophila virilis tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 4)
  67. Drosophila willistoni tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 5)
  68. Drosophila yakuba tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 4)
  69. Frankliniella occidentalis (western flower thrips) tRNA
  70. Gadus morhua tRNA-Gln (CTG) (tRNA-Gln-CTG-3 1 to 4)
  71. Hydractinia symbiolongicarpus (Hydrozoan) transfer RNA glutamine (anticodon CUG)
  72. Lineus longissimus (Bootlace worm) misc RNA ENSLLNG00015025687.1
  73. Lucilia cuprina tRNA-Gln for anticodon CUG
  74. Lucilia sericata (Common green bottle fly) tRNA-Gln
  75. Mercenaria mercenaria (Northern quahog) transfer RNA glutamine (anticodon CUG)
  76. Musca domestica (House fly) transfer RNA glutamine (anticodon CUG)
  77. Mya arenaria (Soft-shell clam) transfer RNA glutamine (anticodon CUG)
  78. Panonychus citri (Citrus red mite) transfer RNA glutamine (anticodon CUG)
  79. Petromyzon marinus tRNA-Gln (CTG) (tRNA-Gln-CTG-4 1 to 3)
  80. Priapulus caudatus (Penis worm) tRNA-Gln
  81. Rhagoletis pomonella (Apple magot fly) tRNA-Gln
  82. Scaptodrosophila lebanonensis tRNA
  83. Stomoxys calcitrans (stable fly) transfer RNA glutamine (anticodon CUG)
  84. Tetranychus urticae tRNA tetur02g15108
  85. Thrips palmi (Melon Thrips) tRNA-Gln
  86. Uranotaenia lowii (Mosquitos) transfer RNA glutamine (anticodon CUG)
  87. Zeugodacus cucurbitae (Melon fly) transfer RNA glutamine (anticodon CUG)
Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Publications