Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-28-3p URS00001799A3_9606

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CACUAGAUUGUGAGCUCCUGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Canis lupus familiaris (dog) cfa-miR-28
  2. Cricetulus griseus cgr-miR-28-3p
  3. Dasypus novemcinctus (nine-banded armadillo) dno-miR-28-3p
  4. Daubentonia madagascariensis (aye-aye) dma-miR-28
  5. Echinops telfairi Ete-Mir-28-P1_3p (mature (guide))
  6. Equus caballus eca-miR-28-3p
  7. Macaca mulatta (Rhesus monkey) mml-miR-28-3p
  8. Microcebus murinus (gray mouse lemur) mmr-miR-28
  9. Nomascus leucogenys nle-miR-28
  10. Pteropus alecto pal-miR-28-3p
  11. Rattus norvegicus (Norway rat) rno-miR-28-3p
  12. Sus scrofa ssc-miR-28-3p
Publications