Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Saccharomyces cerevisiae S288C Small Nucleolar RNA URS0000176EA1_559292

mRNA interactions 6 total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCCCUAUGAUUAAAAAUUAUUAAUCAUAUACCAAUUGUUCCGACUGAAUAGUGGUUUAACUACAUGUCGACAACCCUUUUUCGUUAAGUUUCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 100 other species

  1. Saccharomyces cerevisiae (baker's yeast) SNR41
  2. Saccharomyces cerevisiae EC1118 SNR41
  3. Saccharomyces cerevisiae Kyokai no. 7 K7_snR41
  4. Saccharomyces cerevisiae P283 SNR41
  5. Saccharomyces cerevisiae P301 SNR41
  6. Saccharomyces cerevisiae PE-2 SNR41
  7. Saccharomyces cerevisiae R008 SNR41
  8. Saccharomyces cerevisiae R103 SNR41
  9. Saccharomyces cerevisiae YJM1078 SNR41
  10. Saccharomyces cerevisiae YJM1083 SNR41
  11. Saccharomyces cerevisiae YJM1129 SNR41
  12. Saccharomyces cerevisiae YJM1133 SNR41
  13. Saccharomyces cerevisiae YJM1190 SNR41
  14. Saccharomyces cerevisiae YJM1199 SNR41
  15. Saccharomyces cerevisiae YJM1202 SNR41
  16. Saccharomyces cerevisiae YJM1208 SNR41
  17. Saccharomyces cerevisiae YJM1242 SNR41
  18. Saccharomyces cerevisiae YJM1244 SNR41
  19. Saccharomyces cerevisiae YJM1248 SNR41
  20. Saccharomyces cerevisiae YJM1250 SNR41
  21. Saccharomyces cerevisiae YJM1252 SNR41
  22. Saccharomyces cerevisiae YJM1273 SNR41
  23. Saccharomyces cerevisiae YJM1304 SNR41
  24. Saccharomyces cerevisiae YJM1307 SNR41
  25. Saccharomyces cerevisiae YJM1311 SNR41
  26. Saccharomyces cerevisiae YJM1326 SNR41
  27. Saccharomyces cerevisiae YJM1332 SNR41
  28. Saccharomyces cerevisiae YJM1336 SNR41
  29. Saccharomyces cerevisiae YJM1338 SNR41
  30. Saccharomyces cerevisiae YJM1341 SNR41
  31. Saccharomyces cerevisiae YJM1342 SNR41
  32. Saccharomyces cerevisiae YJM1355 SNR41
  33. Saccharomyces cerevisiae YJM1356 SNR41
  34. Saccharomyces cerevisiae YJM1381 SNR41
  35. Saccharomyces cerevisiae YJM1383 SNR41
  36. Saccharomyces cerevisiae YJM1385 SNR41
  37. Saccharomyces cerevisiae YJM1386 SNR41
  38. Saccharomyces cerevisiae YJM1387 SNR41
  39. Saccharomyces cerevisiae YJM1388 SNR41
  40. Saccharomyces cerevisiae YJM1389 SNR41
  41. Saccharomyces cerevisiae YJM1399 SNR41
  42. Saccharomyces cerevisiae YJM1400 SNR41
  43. Saccharomyces cerevisiae YJM1401 SNR41
  44. Saccharomyces cerevisiae YJM1402 SNR41
  45. Saccharomyces cerevisiae YJM1415 SNR41
  46. Saccharomyces cerevisiae YJM1417 SNR41
  47. Saccharomyces cerevisiae YJM1418 SNR41
  48. Saccharomyces cerevisiae YJM1419 SNR41
  49. Saccharomyces cerevisiae YJM1433 SNR41
  50. Saccharomyces cerevisiae YJM1434 SNR41
  51. Saccharomyces cerevisiae YJM1439 SNR41
  52. Saccharomyces cerevisiae YJM1443 SNR41
  53. Saccharomyces cerevisiae YJM1444 SNR41
  54. Saccharomyces cerevisiae YJM1447 SNR41
  55. Saccharomyces cerevisiae YJM1450 SNR41
  56. Saccharomyces cerevisiae YJM1460 SNR41
  57. Saccharomyces cerevisiae YJM1477 SNR41
  58. Saccharomyces cerevisiae YJM1478 SNR41
  59. Saccharomyces cerevisiae YJM1479 SNR41
  60. Saccharomyces cerevisiae YJM1526 SNR41
  61. Saccharomyces cerevisiae YJM1527 SNR41
  62. Saccharomyces cerevisiae YJM1549 SNR41
  63. Saccharomyces cerevisiae YJM1573 SNR41
  64. Saccharomyces cerevisiae YJM1574 SNR41
  65. Saccharomyces cerevisiae YJM1592 SNR41
  66. Saccharomyces cerevisiae YJM1615 SNR41
  67. Saccharomyces cerevisiae YJM189 SNR41
  68. Saccharomyces cerevisiae YJM193 SNR41
  69. Saccharomyces cerevisiae YJM195 SNR41
  70. Saccharomyces cerevisiae YJM244 SNR41
  71. Saccharomyces cerevisiae YJM248 SNR41
  72. Saccharomyces cerevisiae YJM270 SNR41
  73. Saccharomyces cerevisiae YJM271 SNR41
  74. Saccharomyces cerevisiae YJM320 SNR41
  75. Saccharomyces cerevisiae YJM326 SNR41
  76. Saccharomyces cerevisiae YJM428 SNR41
  77. Saccharomyces cerevisiae YJM450 SNR41
  78. Saccharomyces cerevisiae YJM451 SNR41
  79. Saccharomyces cerevisiae YJM453 SNR41
  80. Saccharomyces cerevisiae YJM456 SNR41
  81. Saccharomyces cerevisiae YJM470 SNR41
  82. Saccharomyces cerevisiae YJM541 SNR41
  83. Saccharomyces cerevisiae YJM554 SNR41
  84. Saccharomyces cerevisiae YJM555 SNR41
  85. Saccharomyces cerevisiae YJM627 SNR41
  86. Saccharomyces cerevisiae YJM681 SNR41
  87. Saccharomyces cerevisiae YJM682 SNR41
  88. Saccharomyces cerevisiae YJM683 SNR41
  89. Saccharomyces cerevisiae YJM689 SNR41
  90. Saccharomyces cerevisiae YJM693 SNR41
  91. Saccharomyces cerevisiae YJM969 SNR41
  92. Saccharomyces cerevisiae YJM972 SNR41
  93. Saccharomyces cerevisiae YJM975 SNR41
  94. Saccharomyces cerevisiae YJM978 SNR41
  95. Saccharomyces cerevisiae YJM981 SNR41
  96. Saccharomyces cerevisiae YJM984 SNR41
  97. Saccharomyces cerevisiae YJM987 SNR41
  98. Saccharomyces cerevisiae YJM990 SNR41
  99. Saccharomyces cerevisiae YJM993 SNR41
  100. Saccharomyces cerevisiae YJM996 SNR41
Publications